Metadata-Version: 2.1
Name: variant
Version: 0.0.31
Summary: 
Home-page: https://github.com/yech1990/variant
License: MIT
Keywords: bioinformatics,variant,mutation,RNA modification
Author: Chang Ye
Author-email: yech1990@gmail.com
Requires-Python: >=3.8,<4.0
Classifier: License :: OSI Approved :: MIT License
Classifier: Programming Language :: Python :: 3
Classifier: Programming Language :: Python :: 3.8
Classifier: Programming Language :: Python :: 3.9
Classifier: Programming Language :: Python :: 3.10
Classifier: Programming Language :: Python :: 3.11
Requires-Dist: numpy (>=1.24.0,<2.0.0)
Requires-Dist: pyensembl (>=2.2.4,<3.0.0)
Requires-Dist: rich-click (>=1.6.0,<2.0.0)
Requires-Dist: varcode
Project-URL: Repository, https://github.com/yech1990/variant
Description-Content-Type: text/markdown

# Python pakcage for genomic variant analysis

[![Pypi Releases](https://img.shields.io/pypi/v/variant.svg)](https://pypi.python.org/pypi/variant)
[![Downloads](https://pepy.tech/badge/variant)](https://pepy.tech/project/variant)

## How to use?

```
pip install variant
```

- run `variant-effect` in the command line
- more functions will be supported in the future

## `variant-effect` command can infer the effect of a mutation

```
Usage: variant-effect

  Variant (genomic variant analysis in python)

Options:
  -i, --input TEXT       Input position file.  [required]
                         The input file has 5 columns: `chromosome`, `position`, `strand`, `reference allele`, `alternative allele`.

                         The 3rd column (strand) is not used by default, just for compatibility with RNA mode.
                         By default, the base of reference and alternative allele are based on DNA information
                         For RNA mode (through `-t RNA` argument), the base of reference and alternative allele is reverse complement if the strand is negative(-).

  -o, --output TEXT      Output annotation file
  -r, --reference TEXT   reference species
                         specify reference name, can be human / mouse / dog / cat / chicken ...

  -e, --release INTEGER  ensembl release
                         NOTE: Change the release version to choice different version of genome. eg. set release as 75 for GRCh37.
  -t, --type [DNA|RNA]
  -n, --npad INTEGER     Number of padding base to call motif.
  -a, --all-effects      Output all effects.
  -H, --with-header      With header line in input file.
  -c, --columns INTEGER  Sets columns for site info.
                         (Chrom,Pos,Strand,Ref,Alt)  [default: 1, 2, 3, 4, 5]
  --help                 Show this message and exit.
```

> demo:

Store the following table in file (`sites.tsv`).

|       |           |     |     |     |
| :---- | :-------- | :-- | :-- | :-- |
| chr1  | 230703034 | -   | C   | T   |
| chr2  | 215361150 | -   | A   | T   |
| chr2  | 84906537  | +   | C   | T   |
| chr3  | 10301112  | -   | G   | T   |
| chr3  | 20301112  | -   | G   | T   |
| chr7  | 45893389  | +   | G   | T   |
| chr7  | 94669540  | +   | G   | N   |
| chr12 | 69353439  | +   | A   | T   |
| chr14 | 23645352  | +   | G   | T   |

Run command `variant-effect -i sites.tsv -r human -e 106 -t RNA` to get the following output.

| #chrom | pos       | strand | ref | alt | mut_type      | gene_name               | gene_pos | transcript_name             | transcript_pos | transcript_motif      | coding_pos | codon_ref | aa_pos | aa_ref | distance2splice |
| :----- | :-------- | :----- | :-- | :-- | :------------ | :---------------------- | :------- | :-------------------------- | :------------- | :-------------------- | :--------- | :-------- | :----- | :----- | :-------------- |
| chr1   | 230703034 | -      | G   | A   | ThreePrimeUTR | ENSG00000135744(AGT)    | 42543    | ENST00000680041(AGT-208)    | 1753           | TGTGTCACCCCCAGTCTCCCA | None       | None      | None   | None   | 295             |
| chr2   | 215361150 | -      | T   | A   | ThreePrimeUTR | ENSG00000115414(FN1)    | 74924    | ENST00000323926(FN1-201)    | 8012           | GGCCCGCAATACTGTAGGAAC | None       | None      | None   | None   | 476             |
| chr2   | 84906537  | +      | C   | T   | ThreePrimeUTR | ENSG00000034510(TMSB10) | 882      | ENST00000233143(TMSB10-201) | 327            | CCTGGGCACTCCGCGCCGATG | None       | None      | None   | None   | 148             |
| chr3   | 10301112  | -      | C   | A   | Silent        | ENSG00000157020(SEC13)  | 20001    | ENST00000397117(SEC13-209)  | 1441           | TTGATCATCTGCCTTAACGTG | 849        | CTG       | 283    | L      | 35              |
| chr3   | 20301112  | -      | C   | A   | Intergenic    | None                    | None     | None                        | None           | None                  | None       | None      | None   | None   | None            |
| chr7   | 45893389  | +      | G   | T   | ThreePrimeUTR | ENSG00000146678(IGFBP1) | 5030     | ENST00000275525(IGFBP1-201) | 1243           | CAAAGCTCCTGCGTCTGTTTT | None       | None      | None   | None   | 429             |
| chr7   | 94669540  | +      | G   | N   | ThreePrimeUTR | ENSG00000242265(PEG10)  | 13216    | ENST00000612941(PEG10-206)  | 6240           | TTTTACCCCTGTCAGTAGCCC | None       | None      | None   | None   | 5030            |
| chr12  | 69353439  | +      | A   | T   | ThreePrimeUTR | ENSG00000090382(LYZ)    | 5059     | ENST00000261267(LYZ-201)    | 695            | TAGAACTAATACTGGTGAAAA | None       | None      | None   | None   | 286             |
| chr14  | 23645352  | +      | G   | T   | ThreePrimeUTR | ENSG00000100867(DHRS2)  | 15238    | ENST00000344777(DHRS2-202)  | 1391           | CTGCCATTCTGCCAGACTAGC | None       | None      | None   | None   | 210             |

## TODO:

- imporve speed. Base on [cgranges](https://github.com/lh3/cgranges), [pyranges](https://github.com/biocore-ntnu/pyranges)?, or [BioCantor](https://github.com/InscriptaLabs/BioCantor)?

