Metadata-Version: 2.1
Name: synbio
Version: 0.2.0
Summary: Synbio design and build library
Home-page: UNKNOWN
Author: JJTimmons
Author-email: jtimmons@latticeautomation.com
License: UNKNOWN
Platform: UNKNOWN
Classifier: Programming Language :: Python :: 3
Classifier: License :: OSI Approved :: MIT License
Classifier: Operating System :: OS Independent
Description-Content-Type: text/markdown

# synbio

`synbio` is a library for designing and assembling DNA. Users can design plasmids or libraries and export multi-step build protocols. Input SeqRecords; output assembly SeqRecords, protocols, plate maps, and robotic picklists.

## Installation

```bash
pip3 install synbio
```

## Models

Designed to have a minimalist API, `synbio` only expects the user to define their `Design` and `Protocol` (list of steps). Several protocols are pre-defined.

- `SeqRecord` - [BioPython](https://biopython.org/)
- `Design`
  - `Plasmid` - single list of SeqRecords to concatenate
  - `Combinatorial` - list of bins for combinatorial assembly

## Example

In the example below, the user specifies a combinatorial library design. Each list (`record_bin`) appended to the design is another bin of `SeqRecords` to try concatenating with all other `SeqRecords` in adjacent bins.

Behind the scenes, `synbio` is filtering all combinations of `SeqRecords` from the design that will circularize into valid plasmids (via [circuits in a graph](https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-015-0544-x/figures/1)). After running the `protocol`, users can export plate maps (`to_csv()`), composite plasmids (`to_fasta()`, `to_genbank()`), and assembly instructions (`to_txt()`, `to_picklists()`).

```python
"""Example of a Combinatorial Golden Gate assembly with steps and output."""

from Bio.SeqIO import parse

from synbio import Combinatorial, Protocol
from synbio.composite import Golden Gate

# create a combinatorial library design from multiple "bins"
design = Combinatorial()
records = parse("./moclo_parts.fa", "fasta")
for type in ["promoter", "RBS", "CDS", "terminator"]:
    record_bin = [r for r in records if any(f.type == type for f in r.features)]
    design.append(record_bin)  # add a new cominatorial bin

# create a protocol using Golden Gate as the sole composite step and run
protocol = Protocol(name="Combinatorial Golden Gate", design=design)
protocol.add(GoldenGate())
protocol.run()

# export all the output plasmids to a multi-FASTA
protocol.to_fasta("composite_parts.fasta")

# export plate layouts
protocol.to_csv("plate_layouts.csv")

# export human protocol
protocol.to_txt("protocol.txt")

# export a hamilton picklist
protocol.to_picklists("robotic_picklist.gwl", platform="tecan")
```

_composite_parts.fasta_

```txt
>J23100_AB|B0032m_BC|C0012m_CD|B0015_DE|DVK_AE
GGAGTTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGCTACTAGAGTCACACAGGAAAG
TACTAAATGATGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGT
...
```

_combinatorial_moclo.csv_

```csv
Setup PCR plate with (volumes) shown:
Plate 1,1,2,3,4,5,6,7,8,9,10,11,12
A,B0015_DE (4),C0080_CD (18),R0010_AB (54),water (36)
B,B0015_DE (160),DVK_AE (160),cre_CD (18),water (156)
...
```

_protocol.txt_

```txt
Combinatorial GoldenGate
1. Setup PCR plate with (volumes) shown:
	1.1. Dilute plasmid DNA to 75 ng/µL in 'water'
	1.2. Create 'assembly-mix' from 1:1 T4 Ligase Buffer (10X) and NEB Golden Gate Assembly Mix
...
```

_robotic_picklist.gwl_

```txt
A;Plate:2;;;15;;2.0;;;
D;Plate:3;;;80;;2.0;;;
W;;;;;;;;;
...
```

## Alternatives

This is a non-exhaustive list. Contact me for a comparison of these libraries/platforms.

- [Aquarium](https://www.aquarium.bio/) is an extensive library/application for LIMS, protocol definition/execution, and workflow design.
- [Autoprotocol](https://github.com/autoprotocol/autoprotocol-python) is a specification standard for experiments in the life sciences.
- [BioBricks](https://github.com/liaupm/BioBlocks) is a general focus, web-based editor for describing experiments in Biology.
- [Biocoder](https://jbioleng.biomedcentral.com/articles/10.1186/1754-1611-4-13) is a C++ library with _extensive_ protocol definition capabilities.
- [Plateo](https://github.com/Edinburgh-Genome-Foundry/Plateo) is a python library for planning, running and checking laboratory experiments. Great for parsing and exporting plates and picklists form multiple formats.
- [pydna](https://github.com/BjornFJohansson/pydna) is a python DNA assembly simulation library with a human-readable description of cloning and assembly strategies.


