Metadata-Version: 2.4
Name: snailz
Version: 1.0.0
Summary: Synthetic data generator for snail mutation survey
Project-URL: home, https://github.com/gvwilson/snailz
Author-email: Greg Wilson <gvwilson@third-bit.com>
License-File: LICENSE.md
Keywords: open science,synthetic data
Requires-Python: >=3.12
Requires-Dist: click
Requires-Dist: faker
Requires-Dist: pydantic
Provides-Extra: dev
Requires-Dist: build; extra == 'dev'
Requires-Dist: doit; extra == 'dev'
Requires-Dist: griffe-fieldz; extra == 'dev'
Requires-Dist: markdown-include; extra == 'dev'
Requires-Dist: mkdocs-click; extra == 'dev'
Requires-Dist: mkdocs-material; extra == 'dev'
Requires-Dist: mkdocstrings[python]; extra == 'dev'
Requires-Dist: pyfakefs; extra == 'dev'
Requires-Dist: pyright; extra == 'dev'
Requires-Dist: pytest; extra == 'dev'
Requires-Dist: pytest-cov; extra == 'dev'
Requires-Dist: ruff; extra == 'dev'
Requires-Dist: twine; extra == 'dev'
Description-Content-Type: text/markdown

# Snailz

<img src="https://raw.githubusercontent.com/gvwilson/snailz/main/pages/img/snail-logo.svg" alt="snail logo" width="200px">

`snailz` is a synthetic data generator
that models a study of snails in the Pacific Northwest
which are growing to unusual size as a result of exposure to pollution.
The package can generate datasets of varying sizes and with varying statistical properties
in a fully reproducible way,
and is intended primarily for classroom use.
For example,
an instructor can give each learner a unique dataset to analyze,
while learners can test their analysis pipelines using datasets they generate themselves.
`snailz` can also be used to teach good software development practices:
it is well structured,
well tested,
and uses modern Python tools.

> *The Story*
>
> Years ago,
> logging companies dumped toxic waste in a remote region of Vancouver Island.
> As the containers leaked and the pollution spread,
> some of the tree snails in the region began growing unusually large.
> You are collecting and analyzing specimens from affected regions
> to determine if a mutant gene makes snails more susceptible to the pollution.

`snailz` generates four related sets of data:

**Persons**
:   The scientists conducting the study.
    Persons are included in the dataset to simulate operator bias,
    i.e.,
    the tendency for different people to perform experiments in slightly different ways.

**Surveys**
:   The locations where specimens are collected.
    Each survey site is represented as a square grid of pollution readings.

**Specimens**
:   The snails collected from the sites.
    The data records where the snail was found,
    the date it was collected,
    its mass,
    and a short fragment of its genome.

**Assays**
:   The chemical analysis of the snails' genomes.
    One assay is performed for each snail
    by putting samples of the snail's tissue and samples of an inert control material
    in small wells in a glass plate.
    The wells are then treated with various chemicals and measured photographically.
    Each assay is stored in two files:
    a design file showing which wells contain samples and controls,
    and a readings file with the measured responses.

## Usage

1.  `pip install snailz` (or the equivalent command for your Python environment).
1.  `snailz --help` to see available commands.

| Command   | Action |
| --------- | ------ |
| data      | Generate all data files. |
| params    | Generate parameter files with default values. |

To generate example data in a fresh directory:

```
# Create and activate Python virtual environment
$ uv venv
$ source .venv/bin/activate

# Install snailz and dependencies
$ uv pip install snailz

# Write default parameter values to ./params/ directory
$ snailz params --output params

# Generate all output files in ./data directory
$ snailz data --params params --output data
```

## Parameters

`snailz` reads controlling parameters from a JSON file,
and can generate a file with default parameter values as a starting point.
The parameters, their meanings, and their properties are:

| Group | Name | Purpose | Default | Notes |
| ----- | ---- | ------- | ------- | ----- |
| overall | `seed` | random number generation seed | 7493418 | non-negative integer |
| `assay` | `baseline` | assay reading for non-mutant specimens | 1.0 | non-negative real |
| | `degrade` | reading degradation per day between sample collection and assay | 0.05 | non-negative real |
| | `delay` | maximum days of delay between sample collection and assay | 5 | non-negative integer |
| | `mutant` | assay reading for mutant specimens | 10.0 | non-negative real, greater than `baseline` |
| | `noise` | random noise for readings | 0.1 | non-negative real |
| | `plate_size` | number of rows and columns in assay plate | 4 | non-negative integer |
| `survey` | `number` | number of survey sites | 3 | non-negative integer |
| | `size` | survey grid size | 15 | non-negative integer |
| | `start_date` | overall survey start date | 2024-03-01 | ISO date |
| | `max_interval` | maximum number of days between specimen samples | 7 | non-negative integer |
| `person` | `locale` | locale for random name generation | `et_EE` (Estonia) | valid ISO locale |
| | `number` | number of persons | 5 | non-negative integer |
| `specimen` | `length` | genome length in bases | 20 | non-negative integer |
| | `max_mass` | maximum unmutated snail mass | 10.0 | non-negative real |
| | `num_mutations` | maximum number of mutations in genome | 5 | non-negative integer |
| | `spacing` | space between snail specimens | 3.75 | non-negative real |

Notes:

1.  The actual readings for mutated and unmutated snails are randomly generated
    by adding uniform noise to `assay.baseline` and `assay.mutant`.
    The readings for control wells are just noise.

1.  Reading values for both mutated and unmutated snails are lowered
    by an amount that depends on the number of days between the sample being collected
    and the assay being performed.

1.  Survey sites are sampled one by one,
    i.e.,
    all of the samples from one site are collected before any samples are collected from the next.

1.  All snail genomes are the same length,
    and are generated by mutating the bases at a few randomly-chosen locations.
    One of those locations and one of the variant bases is selected at random;
    a snail with that mutant base in that location is a mutant
    and grows to unusual size.

1.  Specimens are spaced apart within the survey grid
    by an amount that depends on their size;
    on average,
    larger specimens have more space around them.

1.  The pollution values in survey grids are generated by performing a random walk of the grid,
    adding one to each cell's value each time it is visited.
    The random walk starts when the polluted region reaches the boundary of the survey grid.

## Data Dictionary

All of the generated data is stored in a single JSON file called `data.json`.
It can be read and analyzed directly,
but it is more realistic to use the data described below.

### Persons

`persons.csv` contains information about the scientists performing the study.
The file looks like this:

| ident  | personal | family   |
| :----- | :------- | :------- |
| aa1942 | Artur    | Aasmäe   |
| kk0085 | Katrin   | Kool     |
| …      | …        | …        |

and its fields are:

| Field | Purpose | Properties |
| ----- | ------- | ---------- |
| `ident` | identifier | text, unique, required |
| `personal` | personal name | text, required |
| `family` | family name | text, required |

### Surveys

The `surveys` directory contains one CSV file for each survey site.
Each file's name has the form <code>S<em>nnn</em>.csv</code> (e.g., `S165.csv`),
where <code>S<em>nnn</em></code> is the survey site's unique identifier.
These CSV files do *not* have column headers;
instead, each contains a square integer matrix of pollution readings.
A typical file is:

```
0,0,0,0,0,0,0,0,0,0,0,0,0,0,0
0,0,0,0,0,0,0,0,0,1,1,0,0,0,0
0,0,0,0,0,0,0,0,1,2,1,0,0,0,0
0,0,0,0,0,0,0,0,2,1,0,0,0,0,0
0,0,0,0,0,0,0,1,2,0,0,0,0,0,0
0,0,0,0,0,0,0,1,2,1,0,0,0,0,0
0,0,0,0,0,0,0,0,1,2,0,0,0,0,0
0,0,0,0,0,0,0,2,2,1,0,0,0,0,0
0,0,0,0,0,0,0,1,3,0,0,0,0,0,0
0,0,0,0,0,0,0,1,3,1,0,0,0,0,0
0,0,0,0,0,0,0,0,0,0,0,0,0,0,0
0,0,0,0,0,0,0,0,0,0,0,0,0,0,0
0,0,0,0,0,0,0,0,0,0,0,0,0,0,0
0,0,0,0,0,0,0,0,0,0,0,0,0,0,0
0,0,0,0,0,0,0,0,0,0,0,0,0,0,0
```

### Specimens

`specimens.csv` holds information about individual snails in CSV format (with column headers).
The file looks like this:

| ident  | survey |  x |  y | collected  | genome               | mass |
| :----- | :----- | -: | -: | :--------- | :------------------- | ---: |
| KHNKDL | S165   | 11 |  4 | 2024-03-01 | GCAACCGGACCGCCGTAAGG | 3.82 |
| DZYIPY | S165   |  3 |  7 | 2024-03-01 | TCATACGGACCGCCGTAAGG | 3.53 |
| … | … | … | … | … | … | … |

and its fields are:

| Field | Purpose | Properties |
| ----- | ------- | ---------- |
| `ident` | specimen identifier | text, unique, required |
| `survey` | survey identifier | text, required |
| `x` | collection X coordinate within survey grid | integer, required |
| `y` | collection Y coordinate within survey grid | integer, required |
| `collected` | collection date | ISO date, required |
| `genome` | base sequence | text, required |
| `mass` | snail weight in grams | real, required |

### Assays

Summary information about all assays is stored in `assays.csv`.
The file looks like this:

| ident  | specimen | person | performed  |
| :----  | :------- | :----- | :--------- |
| 386915 | KHNKDL   | km3478 | 2024-03-05 |
| 508199 | DZYIPY   | mt8294 | 2024-03-01 |
| …      | …        | …      | …          |

and its fields are:

| Field | Purpose | Properties |
| ----- | ------- | ---------- |
| `ident` | assay identifier | text, required |
| `specimen` | specimen identifier | text, required |
| `person` | scientist identifier | text, required |
| `performed` | assay date | ISO date, required |

The `assays` directory contains two files for each assay:
a design file <code><em>nnnnnn</em>_treatments.csv</code>
showing whether specimen samples or control material was placed in each well of the assay plate,
and a readings file <code><em>nnnnnn</em>_readings.csv</code>
with the reading from each well.
Each file contains a multi-line header with metadata followed by
a table of well values with row and column labels.
A typical design file is:

```
id,037356,,,
specimen,AMEMRZ,,,
date,2024-03-11,,,
by,pv8677,,,
,A,B,C,D
1,S,C,C,S
2,C,C,S,C
3,S,C,S,S
4,C,S,C,S
```

while a typical readings file is:

```
id,037356,,,
specimen,AMEMRZ,,,
date,2024-03-11,,,
by,pv8677,,,
,A,B,C,D
1,1.09,0.08,0.02,1.1
2,0.02,0.02,1.0,0.07
3,1.03,0.03,1.1,1.07
4,0.09,1.02,0.04,1.01
```

The first four rows of each file have:

| Field | Purpose | Properties |
| ----- | ------- | ---------- |
| `id`  | assay identifier | text, required |
| `specimen` | specimen identifier | text, required |
| `date` | assay date | ISO date, required |
| `by` | scientist identifier | text, required |

The `assays` directory also contains a third file for each assay called <code><em>nnnnnn</em>_raw.csv</code>.
Each of these files contains the same data as the assay's readings file,
but has some deliberate errors:
header rows may be missing or out of order,
data may be indented,
and so on.
These files are provided so that people can learn how to deal with messy real-world data.

### Database

All of the data about people, specimens, and assays is also stored in
a SQLite database called `snailz.db`,
whose structure is shown below.

<div align="center">
  <img src="https://raw.githubusercontent.com/gvwilson/snailz/main/pages/img/schema.svg" alt="database schema">
</div>

## Colophon

`snailz` was inspired by the [Palmer Penguins][penguins] dataset
and by conversations with [Rohan Alexander][alexander-rohan]
about his book [*Telling Stories with Data*][telling-stories].

The snail logo was created by [sunar.ko][snail-logo].

[alexander-rohan]: https://rohanalexander.com/
[penguins]: https://allisonhorst.github.io/palmerpenguins/
[snail-logo]: https://www.vecteezy.com/vector-art/7319786-snails-logo-vector-on-white-background
[telling-stories]: https://tellingstorieswithdata.com/
