Metadata-Version: 2.1
Name: shrs
Version: 0.8.4
Summary: This package contains the programs that design primer set for microbiological analysis and perform some accessory analysis.
Home-page: UNKNOWN
Author: Masayuki TAKAHASHI
License: MIT License
Platform: UNKNOWN
Classifier: Programming Language :: Python :: 3
Classifier: Programming Language :: Python :: 3.8
Classifier: License :: OSI Approved :: MIT License
Classifier: Operating System :: OS Independent
Requires-Python: >=3.8
Description-Content-Type: text/markdown
Requires-Dist: psutil
Requires-Dist: numpy
Requires-Dist: pandas
Requires-Dist: scipy
Requires-Dist: tqdm
Requires-Dist: chardet
Requires-Dist: biopython
Provides-Extra: gpu
Requires-Dist: cupy ; extra == 'gpu'

# Project description
`shrs`

Primer design method based on short length homologous region exhaustive search algorithm.
***
## Table of Contents
- `shrs`
	- Table of Contents
	- [Overview](#overview)
    - [Environment](#environment)
	- [Installation](#installation)
		- pip
		- Installing from the source code
			- Download source code
            - Installation from source
    - [How to run `shrs`](#how-to-run-shrs)
        - [Sample data](#sample-data)
        - [Workflow for design primer](#workflow-for-design-primer)
            1. [Design primer sets for identification without input data preprocessing.](#1-design-primer-sets-for-identification-without-input-data-preprocessing)
            2. [Design universal primer sets without input data preprocessing.](#2-design-universal-primer-sets-without-input-data-preprocessing)
            3. [Design primer sets for identification with input data preprocessing.](#3-design-primer-sets-for-identification-with-input-data-preprocessing)
            4. [Design universal primer sets with input data preprocessing.](#4-design-universal-primer-sets-with-input-data-preprocessing)
        - [Re-analysis/Additional analysis](#re-analysisadditional-analysis)
        - [*in silico* PCR](#in-silico-pcr)
        - [Tips:Some command line options](#tips-some-command-line-options)
        - [Command-line options](#command-line-options)
    - [Functions contained in library of `shrs`](#functions-contained-in-library-of-shrs)
    - [License](#license)

---
<a id = "overview"></a>
# Overview
This package contains the programs that design a primer set for the analysis of bacteria and perform some accessory analyses.
This package contains the following five subcommands.
- `AA` (For Additional Analysis)
- `DIP` (For design identification primer sets)
- `DUP` (For design universal primer sets)
- `ISP` (For input sequence preprocessing)
- `iPCR` (For *insilico* PCR)

You can get a summary of the available command-line options of each command by using the following command:
`shrs`, `shrs {subcommand} -h`.
Every program accepts FASTA or GenBank format sequence files.

---
<a id = "environment"></a>
# Environment
This package passed the operation verification under Windows 10 and Ubuntu 18.04.
When the 'cupy' package is available, some calculations will be performed using the GPU.
The 'cupy' package is NOT installed automatically, even if you use the `pip install shrs` command.
Please install the version of the 'cupy' package that matches the version of CUDA on your computer by yourself.
Type `pip install shrs[GPU]` if you would like to install 'cupy' packages automatically.
**Analyses by a PC with a GPU are highly recommended.** The processing time when a GPU is used could be less than that when a CPU is used.

---
<a id = "installation"></a>
# Installation
## `pip`

Type the following command.
```
 $ pip install shrs
```

## Installing from the source code
### Download source code
Download the source from the following URL.
https://pypi.org/project/shrs/#files

### Installation from source
Place the source file on the current working directory, and then type the following commands.

```
 $ tar -xvzf shrs-0.8.4.tar.gz
 $ cd shrs-0.8.4
 $ python setup.py build
 $ python setup.py install
```

---
<a id = "how-to-run-shrs"></a>
# How to run `shrs`
To confirm a subcommand, type `shrs`. The following message will be shown.
```
usage: shrs [-h] [-v] {AA,DIP,DUP,ISP,iPCR} ...

--- HELP message ---

positional arguments:
  {AA,DIP,DUP,ISP,iPCR}
    AA                  see 'AA -h'. Make a fragment size matrix from a new template sequence and the result containing primer sets that you have already generated.
    DIP                 see 'DIP -h'. Primer design algorithm for the identification of bacteria
    DUP                 see 'DUP -h'. Primer design algorithm for universal primer
    ISP                 see 'ISP -h'. Input sequences preprocessing program for DUP or DIP
    iPCR                see 'iPCR -h'. In silico PCR amplification algorithm

optional arguments:
  -h, --help            show this help message and exit
  -v, --version         show program's version number and exit
```

<a id = "sample-data"></a>
## Sample data
Sample data can be downloaded from [here](https://github.com/ilvsblfsh/SampleData/raw/main/SampleData.zip)

|Algorithm|Hash value|
|:---|:---|
|MD5|956ea1f898ecc2b4613440931e0e8f8a|
|SHA1|c61c2d82ccf4ede3c048b2b34a04fe1af4b857c6|
|SHA256|e3ab7ecf8b574552947684d3259315a53ae8db0aeb764fc30fc7d8058e47bcef| 

Sample data contain a multi-FASTA file of complete genome DNAs of three strains of *Mycoplasma genitalium*, a FASTA file of the complete genome DNA of one strain of *Mycoplasma pneumoniae*, a multi-FASTA file of 25 contig sequences of *Mycoplasma genitalium* G37 and GenBank files of the complete genome DNAs of five strains of Mycoplasma genitalium. Place SampleData in the current working directory.

<a id = "workflow-for-design-primer"></a>
## Workflow for design primer
<img src="https://github.com/ilvsblfsh/SampleData/blob/main/Workflow.png?raw=true" width=760px alt="Workflow">

<a id = "1-design-primer-sets-for-identification-without-input-data-preprocessing"></a>
### 1. Design primer sets for identification without input data preprocessing.
Specify the multi-FASTA file or the folder containing target sequences (FASTA or GenBank format) as input file(s) after the '-i' option.
```
 $ shrs DIP -i SampleData/Mgenitalium_3strains.fasta -o SampleData/ --Search_mode sparse
```
It takes approx. 20 minutes to 2 hours, depending on the PC's performance. After the analysis, the results will be output in a `SampleData/Result/(Timestamp)identify_primer_set/` folder. The CSV file contains a results table as shown below with the analysis parameters.

|| Arguments |
|:--|--:|
| Input_file_name | sample.fasta |
| Target | Strain1, Strain2, ... , Strain N |
| Exclude_file_name | None |
| Exclude ||
| Probe_size_range_description | 23-25 |
| allowance | 0.15 |
| cut_off_lower | 50 |
| cut_off_upper | 1000 |
| Interval_distance | 10000 |
| Match_rate | 0.8 |
| Result_output | 10000 |
| Search_mode | sparse |
| Window_size | 950 |
| Maximum_annealing_site_number | 5 |
| Score_calculation_mode | Fragment |


| Primer1 | Primer2 | Input sequence1 | Input sequence2 | ... | Input sequenceN | Score | Fragment number | Forward Tm_value | Reverse Tm_value | Tm_value difference |
|:-:|:-:|:-:|:-:|:-:|:-:|:-:|:-:|:-:|:-:|:-:|
| ATG..AA | AGC..TA | [(655, 1.0)] | [(528, 1.0)] | ... | [(411, 1.0)] | 1200 | N | 60.0 | 61.5 | 1.5 |
| TAG..TC | GCC..TG | [(344, 1.0)] | [(257, 1.0)] | ... | [(499, 1.0)] | 1200 | N | 58.0 | 60.5 | 2.5 |

Input sequence columns indicate the amplicon length amplified by Primers 1 and 2 and its ratio to the total amplicon number [(Amplicon length, Ratio)]. Therefore, if a primer set produces three amplicons (355 bp, 355 bp, and 652 bp) from whole genome DNA, the results would be [(355, 0.67), (652, 0.33)]. This algorithm `DIP` designs primer sets that produce fragments from all input sequences and **maximizes** the differences in the amplicon size or amplicon sequence among input sequences.
To confirm command-line options, type `shrs DIP -h`.

<a id = "2-design-universal-primer-sets-without-input-data-preprocessing"></a>
### 2. Design universal primer sets without input data preprocessing.
Specify the Multi-FASTA or the folder containing the target sequences (FASTA or GenBank format) as input file(s) after the '-i' option. In the following case, the design primer set can amplify genome DNAs of three strains of *Mycoplasma genitalium* and NOT produce any amplicons from genome DNA of one strain of *Mycoplasma pneumoniae*. 
```
 $ shrs DUP -i SampleData/Mgenitalium_3strains.fasta -e SampleData/Mpneumoniae.fasta -a 0.25 -o SampleData/ --Search_mode sparse
```
It takes approx. 5–10 minutes, depending on the PC's performance. After the analysis, the results will be output in a `SampleData/Result/(Timestamp)universal_primer_set/` folder. The format of the outputted CSV file is almost the same as that obtained for the results of a DIP analysis as mentioned above (see Procedure 1). This algorithm `DUP` designs primer sets that produce fragments from all input sequences and **minimizes** the differences in the amplicon size among input sequences. Note that the primer sets are designed to produce only one amplicon from each input sequence when `shrs DUP` is used.

To confirm command-line options, type `shrs DUP -h`.

<a id = "3-design-primer-sets-for-identification-with-input-data-preprocessing"></a>
### 3. Design primer sets for identification with input data preprocessing.
Each sequence that is input into the `DIP` subcommand at the same time is processed for differentiation from each other. Therefore, if an inputted multi-FASTA file has plasmid or multiple contig sequences of an identical strain, the primer set obtained will produce some amplicons that correspond to inputted contigs or plasmid. To avoid this problem, if genome DNA of an identical strain has been divided into multiple contigs, all contigs and the plasmid should be preprocessed (concatenated) prior to the `DIP` analysis, using the following subcommand. One multi-FASTA file for preprocessing must contain the contigs and plasmid derived from a single strain. Organize all multi-FASTA files in one folder when there are some multi-FASTA files, and then specify the folder path as the input file path.
```
 $ shrs ISP -i SampleData/contig/ -o SampleData/Preprocessed_data1/ --Single_file
```
A preprocessed multi-FASTA file will be generated, and then the preprocessed multi-FASTA file is analyzed by `shrs DIP`.

```
 $ shrs DIP -i SampleData/Preprocessed_data1/ -o SampleData/ --Search_mode sparse
```
This algorithm `DIP` designs primer sets that produce fragments from all input sequences and **maximizes** the differences in the amplicon size or amplicon sequence among input sequences.

To confirm command-line options, type `shrs DIP -h` or `shrs ISP -h`.

<a id = "4-design-universal-primer-sets-with-input-data-preprocessing"></a>
### 4. Design universal primer sets with input data preprocessing.
As mentioned above, if genome DNA of an identical strain has been divided into multiple contigs, all contigs and the plasmid should be preprocessed (concatenated) prior to a `DUP` analysis by using following subcommand. One multi-FASTA file for preprocessing must contain contigs and plasmid derived from a single strain. Organize all multi-FASTA files in one folder when there are some multi-FASTA files, and then specify the folder path as the input file path.
```
 $ shrs ISP -i SampleData/contig/ -o SampleData/Preprocessed_data2/ --Single_file
```
A preprocessed multi-FASTA file will be generated, and then the preprocessed multi-FASTA file is analyzed by `shrs DUP`.

```
 $ shrs DUP -i SampleData/Preprocessed_data2 -e SampleData/Mpneumoniae.fasta -a 0.20 -o SampleData/ --Search_mode sparse
```
This algorithm `DUP` designs primer sets that produce fragments from all input sequences and **minimizes** the differences in the amplicon size among input sequences. Note that the primer sets are designed to produce only one amplicon from each input sequence when `shrs DUP` is used.

To confirm command-line options, type `shrs DUP -h` or `shrs ISP -h`.

<a id = "re-analysisadditional-analysis"></a>
## Re-analysis/Additional analysis
New sequences can be analyzed based on primer sets in a CSV file obtained from `shrs DIP` or `shrs DUP`. Delete the rows containing unnecessary primer sets, since an analysis of them would take a long time. Do not include blank rows between the rows containing primer sets.
```
 $ shrs AA -i SampleData/Mgenitalium_M6282.fasta -f SampleData/Previous_DIP_Result.csv -o SampleData/New_result/
```

<a id = "in-silico-pcr"></a>
## *in silico* PCR
You can get amplicon information by using *in silico* PCR. 
```
 $ shrs iPCR -i SampleData/GenBank/ -fwd CTACACCCATTTACCCAACAGTATC -rev TCTCATTGGWAACATTCGGTACATC -o SampleData/insilicoPCR_Result/
```
A CSV file will be output with default settings. If you prefer FASTA over CSV, use the '--fasta' option. When you need to know the primer annealing site positions on a template sequence, use the '--Position_index' option. You can obtain the annotation information of amplicons, when a GenBank file is analyzed by *in silico* PCR with the '--Annotation' option.
```
 $ shrs iPCR -i SampleData/GenBank/ -fwd CTACACCCATTTACCCAACAGTATC -rev TCTCATTGGWAACATTCGGTACATC -o SampleData/insilicoPCR_annotation_Result/ --Annotation
```

<a id = "tips-some-command-line-options"></a>
## Tips: Some command line options
- '--circularDNA'/'--exclude_circularDNA' option {AA, DIP, DUP, ISP, iPCR}

    When input sequence file(s) contains one or more circular DNA sequence(s), use this option. Specify which sequence is circular DNA by using a subargument. All input sequences are processed as linear DNA in default settings ('n/a'). When all input sequences are circular DNA, use 'all' after the --circularDNA/--exclude_circularDNA option. For each individual sequence, you can specify whether the sequence is circular DNA or not by using 'individually'. You can also specify whether or not a sequence is circular DNA by inputting the file path of text file, as shown below.

            Text file example:
                Sequence_name1 circularDNA
                Sequence_name2 linearDNA
                Sequence_name3 linearDNA
                           ... 
                Sequence_nameN circularDNA

```
 $ shrs DIP -i SampleData/Mgenitalium_3strains.fasta -o SampleData/ --Search_mode sparse --circularDNA SampleData/circularDNA.txt
```

- '--Search_mode' option {DIP, DUP}

    The '--Search_mode' option contains four choices: 'exhaustive', 'moderate', 'sparse', and 'manual'. Primer candidates will be generated by cutting every N-base from the reference sequence. The N-value is different depending on each Search_mode.

    | Subargument | N-bases |
    |:--|:--|
    | exhaustive | 1 base. Same as N-gram method (N: primer size) |
    | moderate | One-third of primer size (Maximum: 10 bases) |
    | sparse | primer size |
    | manual | primer size * Ratio inputed by user |

```
 $ shrs DIP -i SampleData/Mgenitalium_3strains.fasta -o SampleData/ --Search_mode manual 2
```

- '-a' option {DIP, DUP}

    When the '-e' and '--Exclude_mode fast' options are used, the larger the value allowance is, the fewer in number the candidates will be.

- '--Score_calculation' option {DIP}

    Cumaltative score of sequence homology among amplicons is used as an indicator to evaluate primer set canditates instead of the score calculated from fragment length when 'Sequence' is specified in this option. Only primer sets which produce single anmplicon from template sequence will be obtained when this option is used, because calculation of sequence homology takes long time.
```
 $ shrs DIP -i SampleData/Mgenitalium_3strains.fasta -o SampleData/ --Search_mode sparse --Score_calculation Sequence
```

<a id = "command-line-options"></a>
## Command-line options
<details><summary>Design identification primer sets {DIP}</summary>

```
shrs DIP -i <input file> [options]
```
Below is the full list of supported options for the `DIP` command line.

|Option|Description|
|:--|:--|
| -i, --input_file | Input file path (required) |
| -e, --exclude_file | File path for exclusion sequence(s). Specify the sequence(s) file path of the bacteria if there are some bacteria that you would like to not amplify. |
| -s, --primer_size | Primer size (default: 25) |
| -a, --allowance | Mismatch allowance ratio (default: 0.15. The value means that a 4-base [25 * 0.15] mismatch is accepted). Note that setting this parameter too large might causes the increased run time and excessive memory consumption. |
| -r, --range | Search range from primer size (default: 0. If the value is 1, the primer sets that have 25–26 base length are explored) |
| -d, --distance | The minimum distance between annealing sites that are hybridized with a primer (default: 10,000) |
| -o, --output | Output directory path (Make a new directory if the directory does not exist) |
| -P, --process | The number of processes (sometimes the number of CPU core) used for analysis |
| --Exclude_mode | Choose the method for excluding the sequence(s) from 'fast' or 'standard' when you specify some sequence(s) file path of the bacteria that you would like to exclude using '-e' option (default: fast.) |
| --Result_output | The upper limit of result output (default: 10,000) |
| --Cut_off_lower | The lower limit of amplicon size (default: 50) |
| --Cut_off_upper | The upper limit of amplicon size (default: 1,000) |
| --Match_rate | The ratio of trials for which the primer candidate fulfilled all criteria when the allowance value is decreased. The higher the number is, the more specific the primer obtained is (default: 0.8) |
| --Chunks | The chunk size for calculation. If the memory usage for calculation using the chunk size exceeds the GPU memory size, the processing unit for calculation will be switched to the CPU automatically (default: Auto) |
| --Maximum_annealing_site_number | The maximum acceptable value of the number of annealing site of the candidate of the primer in the input sequence (default: 5) |
| --Window_size | The duplicated candidates containing this window will be removed (default: 950) |
| --Search_mode | There are four options: exhaustive/moderate/sparse/manual. If you choose the 'manual' option, type the ratio to primer length after 'manual'. (e.g. --Search_mode manual 0.2.) (default: moderate when the average input sequence length is >5000, and exhaustive when the average input sequence length is ≤5000) |
| --withinMemory | All analyses are performed within memory (default: False) |
| --Without_allowance_adjustment | Use this option if you do not want to modify the allowance value for every homology calculation (default: False) |
| --circularDNA | If there are some circular DNAs in the input sequences, use this option (default: n/a. It means all input sequences are linear DNA. When there are some circular DNA input sequences, type 'all', 'individually', 'n/a', or the file path of the text that specify which sequence is circularDNA, after the '--circularDNA' option.) |
| --exclude_circularDNA | If there are some circular DNAs in the input sequence(s) that you do not want to amplify, use this option (default: n/a. It means all input sequences are linear DNA. When there is some circular DNA in the sequence file for exclusion, type 'all', 'individually', 'n/a', or the file path of the text that specifies which sequence is circularDNA, after the '--exclude_circularDNA' option.) |
| --Score_calculation | The calculation method of the score for identifying microorganisms. Fragment length or sequence. When the 'Sequence' is specified, the primer set that produces only a single amplicon will be obtained in order to reduce computational complexity. |
| --Fragment_size_pattern_matrix | When you have a csv file of fragment size pattern matrix, you can reanalyse from the csv file. Specify the file path (default: None.) |
| --Fragment_start_position_matrix | When you reanalyse from fragment size pattern matrix by 'Sequence' mode, specify the csv file path of fragment start position matrix (default: None.) |
</details>

<details><summary>Design universal primer sets {DUP}</summary>

```
shrs DUP -i <input file> [options]
```
Below is the full list of supported options for the `DUP` command line.

|Option|Description|
|:--|:--|
| -i, --input_file | Input file path (required) |
| -o, --output | Output directory path (Make a new directory if the directory does not exist) |
| -e, --exclude_file | File path for exclusion sequence(s). Specify the sequence(s) file path of the bacteria if there are some bacteria that you would like to not amplify
| -s, --primer_size | Primer size (default: 20) |
| -a, --allowance | Mismatch allowance ratio (default: 0.20. The value means that a 4-base [20 * 0.20] mismatch is accepted). Note that setting this parameter too large might causes the increased run time and excessive memory consumption. |
| -r, --range | Search range from primer size (default: 0. If the value is 1, the primer sets that have 20–21 base length are explored) |
| -d, --distance | The minimum distance between annealing sites that are hybridized with a primer (default: 5,000) |
| -P, --process | The number of processes (sometimes the number of CPU core) used for analysis |
| --Exclude_mode | Choose the method for excluding the sequence(s) from 'fast' or 'standard' when you specify some sequence(s) file path of the bacteria that you would like to exclude using '-e' option (default: fast.) |
| --Cut_off_lower | The lower limit of amplicon size (default: 50) |
| --Cut_off_upper | The upper limit of amplicon size (default: 3,000) |
| --Match_rate | The ratio of trials for which the primer candidate fulfilled all criteria when the allowance value is decreased. The higher the number is, the more specific the primer obtained is (default: 0.0) |
| --Result_output | The upper limit of result output (default: 10,000) |
| --Omit_similar_fragment_size_pair | Use this option if you want to omit primer sets that amplify similar fragment lengths |
| --Window_size | The duplicated candidates containing this window will be removed (default: 50) |
| --Maximum_annealing_site_number | The maximum acceptable value of the number of annealing site of the candidate of the primer in the input sequence (default: unlimited) |
| --Chunks | The chunk size for calculation. If the memory usage for calculation using the chunk size exceeds the GPU memory size, the processing unit for calculation will be switched to the CPU automatically (default: Auto) |
| --Search_mode | There are four options: exhaustive/moderate/sparse/manual. If you choose the 'manual' option, type the ratio to primer length after 'manual'. (e.g. --Search_mode manual 0.2.) (default: moderate when the average input sequence length is >5000, and exhaustive when the average input sequence length is ≤5000) |
| --withinMemory | All analyses are performed within memory (default: False) |
| --Without_allowance_adjustment | Use this option if you do not want to modify the allowance value for every homology calculation (default: False) |
| --circularDNA | If there are some circular DNAs in the input sequences, use this option (default: n/a. It means all input sequences are linear DNA. When there are some circular DNA input sequences, type 'all', 'individually', 'n/a', or the file path of the text that specify which sequence is circularDNA, after the '--circularDNA' option.) |
| --exclude_circularDNA | If there are some circular DNAs in the input sequence(s) that you do not want to amplify, use this option (default: n/a. It means all input sequences are linear DNA. When there is some circular DNA in the sequence file for exclusion, type 'all', 'individually', 'n/a', or the file path of the text that specifies which sequence is circularDNA, after the '--exclude_circularDNA' option.) |
| --Fragment_size_pattern_matrix | When you have a csv file of fragment size pattern matrix, you can reanalyse from the csv file. Specify the file path (default: None.) |
</details>

<details><summary>Input Sequence Preprocessing {ISP}</summary>

```
shrs ISP -i <input file> [options]
```
Below is the full list of supported options for the `ISP` command line.

|Option|Description|
|:--|:--|
| -i, --input_file | Input file path (required) |
| -o, --output | Output directory path (Make a new directory if the directory does not exist) |
| --circularDNA | If there are some circular DNAs in the input sequences, use this option (default: n/a. It means all input sequences are linear DNA. When there are some circular DNA input sequences, type 'all', 'individually', 'n/a', or the file path of the text that specify which sequence is circularDNA, after the '--circularDNA' option.) |
| --circularDNAoverlap | Maximum value of overlapped region in circular DNA (default: 10,000). For reducing computational complexity, you can reduce this value to the larger one of the upper limit of amplicon size and interval distance that will be set by '--Cut_off_upper' and '--distance' in following DIP or DUP. |
| --Single_target | All input files will be concatenated and generated as one sequence if you use this option, even if separated multi-FASTA files are inputted. |
| --Multiple_targets | All input files are recognized as an individual file, and every file is preprocessed separately. |
| --Single_file | When you use the '--Multiple_targets' option and this option, a preprocessed sequence file will be outputted as one multi-FASTA file. |
</details>

<details><summary>Additional Analysis {AA}</summary>

```
shrs AA -i <input file> -f <csv file> [options]
```
Below is the full list of supported options for the `AA` command line.

|Option|Description|
|:--|:--|
| -i, --input_file | Input file path (required) |
| -f, --csv_file | File path of the CSV data obtained from other analysis (DIP or DUP) (required) |
| -o, --output | Output directory path (Make a new directory if the directory does not exist) |
| -s, --size_limit | The upper limit of amplicon size (default: 3,000) |
| -P, --process | The number of processes (sometimes the number of CPU core) used for analysis |
| -fwd, --forward | Forward primer sequence (required if you don't provide a CSV file with the '-f' option) |
| -rev, --reverse | Reverse primer sequence (required if you don't provide a CSV file with the '-f' option) |
| --circularDNA | If there are some circular DNAs in the input sequences, use this option (default: n/a. It means all input sequences are linear DNA. When there are some circular DNA input sequences, type 'all', 'individually', 'n/a', or the file path of the text that specify which sequence is circularDNA, after the '--circularDNA' option.) |
| --warning | Shows all warnings when you use this option |
</details>

<details><summary>in silico PCR {iPCR}</summary>

```
shrs iPCR -i <input file> -fwd <forward primer sequence> -rev <reverse primer sequence> [options]
```
Below is the full list of supported options for the `iPCR` command line.

|Option|Description|
|:--|:--|
| -i, --input_file | Input file path (required) |
| -o, --output | Output directory path (Make a new directory if the directory does not exist) |
| -s, --size_limit | The upper limit of amplicon size (default: 10,000) |
| -P, --process | The number of processes (sometimes the number of CPU core) used for analysis |
| -fwd, --forward | The forward primer sequence used for amplification (required) |
| -rev, --reverse | The reverse primer sequence used for amplification (required) |
| --fasta | Output format. A FASTA file will be generated if you use this option. |
| --Single_file | Output format. One single FASTA-format file will be generated even if you input some separate FASTA files, when using this option with the '--fasta' option. |
| --Mismatch_allowance | The acceptable mismatch number (default: 0) |
| --Only_one_amplicon | Only one amplicon is outputted, even if multiple amplicons are obtained by PCR when you use this option. |
| --Position_index | The result has the information of the amplification position when this option is enabled. |
| --circularDNA | If there are some circular DNAs in the input sequences, use this option (default: n/a. It means all input sequences are linear DNA. When there are some circular DNA input sequences, type 'all', 'individually', 'n/a', or the file path of the text that specify which sequence is circularDNA, after the '--circularDNA' option.) |
| --gene_annotation_search_range | The gene annotation search range in the GenBank-format file. (default: 100) |
| --Annotation | If the input sequence file is in GenBank format, the amplicon(s) is annotated automatically. |
| --warning | Shows all warnings when you use this option |
</details>

---
<a id = "functions-contained-in-library-of-shrs"></a>
# Functions contained in library of `shrs`
- shrslib.basicfunc
    - class nucleotide_sequence
    - complementary_sequence
    - calculate_Tm_value
    - read_sequence_file
- shrslib.explore
    - search_position
    - PCR_amplicon
- shrslib.scores
    - calculate_flexibility
    - calculate_score
    - calculate_diff_length_score
    - fragment_size_distance
    - array_diff
    - sequence_duplicated

See [documentation](https://ilvsblfsh.github.io/SampleData/) for more detailed information.

---
<a id = "license"></a>
# License
**This software is released under the MIT License.**
Copyright (c) 2022 Masayuki TAKAHASHI

Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), 
to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, 
and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions:

The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software.

THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, 
FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, 
WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.

