Metadata-Version: 2.1
Name: rna-tools
Version: 3.8.11
Summary: a toolbox to analyze structures and simulations of RNA
Home-page: https://github.com/mmagnus/rna-tools
Author: Marcin Magnus
Author-email: mag_dex@o2.pl
License: GPLv3
Platform: UNKNOWN
Description-Content-Type: text/markdown
Requires-Dist: numpy
Requires-Dist: biopython
Requires-Dist: progressbar2
Requires-Dist: csvsort
Requires-Dist: urllib3
Requires-Dist: versioneer
Requires-Dist: configparser
Requires-Dist: icecream

<h1 align="center">
  rna-tools
</h1>
<p align="center" style="font-size:20px">
  <b >a toolbox to analyze sequences, structures and simulations of RNA (and way more!)</b>
</p>

<p align="center">
  Look for other our projects at https://github.com/RNA-Puzzles.
</p>


<p>
<div align="center">
	🔥 rna-tools goes online -> https://rna-tools.online 🔥</br></br>

<a href='https://ko-fi.com/R5R6AERGM' target='_blank'><img height='36' style='border:0px;height:36px;' src='https://cdn.ko-fi.com/cdn/kofi2.png?v=3' border='0' alt='Buy Me a Coffee at ko-fi.com' /></a>

</div>

<p align="center">
  <a href="https://twitter.com/rna_tools"><img src="http://img.shields.io/twitter/follow/rna_tools.svg?style=social&label=Follow"></a>
<!--
  <a href="https://github.com/mmagnus/rna-tools/releases"><img src="https://img.shields.io/github/release/mmagnus/rna-tools.svg"></a>-->
  <a href="https://travis-ci.org/mmagnus/rna-tools"><img src="https://travis-ci.org/mmagnus/rna-tools.svg?branch=master"></a>
  <a href="http://rna-tools.readthedocs.io/en/latest/?badge=latest"><img src="https://readthedocs.org/projects/rna-tools/badge/?version=latest"></a> <a href="https://pypi.org/project/rna-tools"><img src="https://badge.fury.io/py/rna-tools.svg" alt="PyPI version"> </a><a href="https://scrutinizer-ci.com/g/mmagnus/rna-tools/?branch=master"><img src="https://scrutinizer-ci.com/g/mmagnus/rna-tools/badges/quality-score.png?b=master"></a>
	<span class="badge-paypal"><a href="https://www.paypal.me/MarcinMagnus" title="Donate to this project using Paypal"><img src="https://img.shields.io/badge/paypal-donate-1?logo=paypal&color=blue.svg" alt="PayPal donate button" /></a></span>

Introduction
-------------------------------------------------------------------------------

<!--
*If you find the tools helpful you can by me a beer via PayPal or Flattr, and if you like the project, please "Star it", so it would be easier to find it for others and to make me happy that the toolbox useful not only for me.*
![](docs/pngs/starit.png)
-->

rna-tools is a core library and a set of programs to run various Python functions related to work, initially, with PDB files of RNA structures, but right now this is a huge toolbox of tools to process various types of RNA data.

**That is why in 2019, after publishing our U6 Molecular Cell paper I decided to rename the package to rna-tools. Simply, various tools to work with RNA data: sequences, alignments, structures, trajectories, RNA-seq data.** If you want access the old version see the [branch](https://github.com/mmagnus/rna-tools/tree/rna-pdb-tools).

The software is used by me in my servers **NPDock** (RNA/DNA-protein docking method, http://genesilico.pl/NPDock/) and **SimRNAweb** (RNA 3D structure prediction method, http://iimcb.genesilico.pl/SimRNAweb/) and **mqapRNA** (RNA 3D quality control, http://iimcb.genesilico.pl/mqapRNA/) and other projects [EvoClustRNA](https://github.com/mmagnus/EvoClustRNA) and [RNA-Puzzles-Normalized-submissions](https://github.com/mmagnus/RNA-Puzzles-Normalized-submissions).

**What is fun here?**

`rna-tools` (formerly rna-pdb-tools) is a packages of shell utils that are using the common core library. You can also access functions of the library from your scripts.

A command-line tools:

```shell
$ rna_pdb_toolsx.py --is-pdb input/1I9V_A.pdb
True
$ rna_pdb_toolsx.py --is-pdb input/image.png
False
```

or from a script:

```python
>>> from rna_tools_lib import *
>>> s = RNAStructure('input/1I9V_A.pdb')
>>> s.is_pdb()
True
```

or from a Jupyter Notebook:

<p align="center">
  <img align="center" src="https://raw.githubusercontent.com/mmagnus/rna-tools/master/docs/pngs/align.png")
</p>

Fig. Fetch an alignment and generate an RChie plot for it. See more <https://github.com/mmagnus/rna-tools/blob/master/rna_tools/tools/rna_alignment/rna_alignment.ipynb>

Take a tour [http://mmagnus.github.io/rna-tools/#/](http://mmagnus.github.io/rna-tools/) and/or read the doc [rna-tools.rtfd.io/en/latest/](http://rna-tools.rtfd.io/en/latest/).

<p align="center">
  <img align="center" src="https://raw.githubusercontent.com/mmagnus/rna-tools/master/docs/pngs/qKPVoPxDmq.gif">
</p>

Fig. `rna_pdb_toolsx.py --get-rnapuzzle-ready *pdb --inplace`

The latest
-------------------------------------------------------------------------------
(see [CHANGELOG](https://github.com/mmagnus/rna-tools/tree/master/CHANGELOG.md) for more detailed description)

**22-05-17** 🔥 a paper published on our server 🔥  

rna-tools.online: a Swiss army knife for RNA 3D structure modeling workflow   
Marcin Magnus   
Nucleic Acids Research     
https://doi.org/10.1093/nar/gkac372

**22-03-31** rna-tools goes online, http://rna-tools.online

**21-05-24**  spotifier branched out into own repository to keep RT light https://github.com/mmagnus/yeast-spotifier

**20-10/12** [mqapRNA](https://github.com/mmagnus/rna-tools/blob/master/notes/mq.ipynb): py3 wrappers and include them in RT: RASP, Dfire, RNA3DCNN, QRNA, FARNA(Rosetta), AnalyzeGeometry, ClashScore, eSCORE (barnaba), 3dRNAscore, RNAkb (5pt)

**20-08-20** A new structures of splicesome processed with rna-tools to be easily viewed with PyMOL (or as single chains) [PyMOL4Spliceosome](https://github.com/mmagnus/PyMOL4Spliceosome)

**20-06-18** A new tool, [spotifier](https://github.com/mmagnus/rna-tools/tree/master/rna_tools/tools/spotifier), to process yeast plate images into figures 

**20-03-21** [PyMOL Preview Generator](https://github.com/mmagnus/rna-tools/tree/master/rna_tools/tools/pymol_preview_generator) a new tool for generation of previews in Finders created :-)

**19-11-08** The RNA-Puzzles toolkit paper has been accepted for publication in Nucleic Acid Research :-) Release v3

RNA-Puzzles toolkit: A computational resource of RNA 3D structure benchmark datasets, structure manipulation, and evaluation tools
Magnus, Marcin; Antczak, Maciej; Zok, Tomasz; Wiedemann, Jakub ; Lukasiak, Piotr; Cao, Yang ; Bujnicki, Janusz; Westhof, Eric; Szachniuk, Marta; Miao, Zhichao
https://academic.oup.com/nar/advance-article/doi/10.1093/nar/gkz1108/5651330

**19-10-22** We made a searchable [index]( https://github.com/mmagnus/rna-tools/blob/master/rna-tools-index.csv) of all the tools. There are around 100 functionalities implemented, enjoy it! Let us know if something is missing or unclear!

**19-10-10** **rna-tools finally works with Python 3, to get Python 2 version go to this [branch](https://github.com/mmagnus/rna-tools/tree/py2)** However, not all tools can be used with Python 3, for example, ClaRNA is written in Python 2 and we can do nothing about it. So, for now, we suggest using Conda or something else that supports kind of hybrid Python2/Python3 environments. Read more on this [here](https://towardsdatascience.com/environment-management-with-conda-python-2-3-b9961a8a5097) and [here](https://docs.anaconda.com/anaconda/user-guide/tasks/switch-environment/)

**19-10-01** The EvoClustRNA manuscript with the heavy use of rna-tools is accepted for publication!

M. Magnus, M., Kappel, K., Das, R., & Bujnicki, J. M. (2019). RNA 3D structure prediction guided by independent folding of homologous sequences, BMC Bioinformatics, https://github.com/mmagnus/EvoClustRNA https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-019-3120-y

**19-06-15** rna-tools used for spliceosome! :-) is accepted for publication! See [this folder](https://github.com/mmagnus/rna-tools/tree/master/U6MolCell) for the description of the analysis!

Eysmont, K., Matylla-Kulinska, K., Jaskulska, A., Magnus, M., & Konarska, M. M. (2018). Rearrangements within the U6 snRNA core at the transition between the two catalytic steps of splicing. Molecular Cell https://github.com/mmagnus/rna-tools/tree/master/U6MolCell https://www.cell.com/molecular-cell/pdfExtended/S1097-2765(19)30390-9 

See also [CHANGELOG](https://github.com/mmagnus/rna-tools/blob/master/CHANGELOG.md).

Table of Contents
-------------------------------------------------------------------------------

   * [Tour](#tour)
   * [rna_pdb_toolsx.py](#rna_pdb_toolsxpy)
   * [Tools](#tools)
   * [Docs](#docs)
   * [Cite](#cite)
   * [Used in papers](#used-in-papers)
   * [RNA Puzzle Submission](#rna-puzzle-submission)
   * [Inspiration (and alternatives)](#inspiration-and-alternatives)
   * [Install](#install)
   * [Index of Tools](#index-of-tools)
      * [rna\_pdb\_toolsx\.py](#rna_pdb_toolsxpy)
      * [Sequence analysis](#sequence-analysis)
      * [Secondary structure analysis](#secondary-structure-analysis)
      * [Tertiary structure comparison](#tertiary-structure-comparison)
      * [Tertiary structure formats](#tertiary-structure-formats)
      * [Tertiary structure analysis](#tertiary-structure-analysis)
      * [Tertiary structure processing](#tertiary-structure-processing)
      * [PyMOL4RNA](#pymol4rna)
      * [SimRNA](#simrna)
      * [Rosetta](#rosetta)
      * [RNA Alignment](#rna-alignment)
      * [Python Classes](#python-classes)
      * [Other](#other)
   * [Index of Jupyter Notebooks](#index-of-jupyters)   
   * [References](#references)

## Tour

Take a tour http://mmagnus.github.io/rna-tools/#/

## rna_pdb_toolsx.py

```
usage: rna_pdb_toolsx.py [-h] [--version] [-r] [--no-progress-bar] [--renum-atoms] [--renum-nmr]
                         [--renum-residues-dirty] [--undo] [--delete-anisou] [--fix] [--to-mol2]
                         [--split-alt-locations] [-c] [--is-pdb] [--is-nmr] [--nmr-dir NMR_DIR]
                         [--un-nmr] [--orgmode] [--get-chain GET_CHAIN] [--fetch] [--fetch-ba]
                         [--fetch-chain] [--get-seq] [--color-seq] [--ignore-files IGNORE_FILES]
                         [--compact] [--hide-warnings] [--get-ss] [--rosetta2generic] [--no-hr]
                         [--renumber-residues] [--dont-rename-chains] [--dont-fix-missing-atoms]
                         [--inspect] [--collapsed-view] [--cv] [-v] [--mutate MUTATE] [--edit EDIT]
                         [--rename-chain RENAME_CHAIN] [--swap-chains SWAP_CHAINS]
                         [--set-chain SET_CHAIN] [--replace-chain REPLACE_CHAIN] [--delete DELETE]
                         [--extract EXTRACT] [--extract-chain EXTRACT_CHAIN] [--uniq UNIQ]
                         [--chain-first] [--oneline] [--replace-htm] [--fasta] [--cif2pdb] [--pdb2cif]
                         [--mdr] [--get-rnapuzzle-ready] [--rpr] [--keep-hetatm] [--inplace]
                         [--suffix SUFFIX] [--replace-hetatm] [--dont-report-missing-atoms]
                         [--backbone-only] [--no-backbone] [--bases-only]
                         file [file ...]

rna_pdb_toolsx - a swiss army knife to manipulation of RNA pdb structures

Usage::

   $ rna_pdb_toolsx.py --delete A:46-56 --inplace *.pdb

    $ rna_pdb_toolsx.py --get-seq *
    # BujnickiLab_RNApuzzle14_n01bound
    > A:1-61
    # BujnickiLab_RNApuzzle14_n02bound
    > A:1-61
    CGUUAGCCCAGGAAACUGGGCGGAAGUAAGGCCCAUUGCACUCCGGGCCUGAAGCAACGCG
    [...]

-v is for verbose, --version for version ;)

positional arguments:
  file                  file

optional arguments:
  -h, --help            show this help message and exit
  --version
  -r, --report          get report
  --no-progress-bar     for --no-progress-bar for --rpr
  --renum-atoms         renumber atoms, tested with --get-seq
  --renum-nmr
  --renum-residues-dirty
  --undo                undo operation of action done --inplace, , rename "backup files" .pdb~ to pdb, ALL files in the folder, not only ~ related to the last action (that you might want to revert, so be careful)
  --delete-anisou       remove files with ANISOU records, works with --inplace
  --fix                 fix a PDB file, ! external program, pdbfixer used to fix missing atoms
  --to-mol2             fix a PDB file, ! external program, pdbfixer used to fix missing atoms
  --split-alt-locations
                        @todo
  -c, --clean           get clean structure
  --is-pdb              check if a file is in the pdb format
  --is-nmr              check if a file is NMR-style multiple model pdb
  --nmr-dir NMR_DIR     make NMR-style multiple model pdb file from a set of files 

                          rna_pdb_toolsx.py --nmr-dir . 'cwc15_u5_fragments*.pdb' > ~/Desktop/cwc15-u5.pdb

                        please use '' for pattern file recognition, this is a hack to deal with folders with
                        thousands of models, if you used only *.pdb then the terminal will complain that you
                        selected to many files.
  --un-nmr              split NMR-style multiple model pdb files into individual models [biopython]
  --orgmode             get a structure in org-mode format <sick!>
  --get-chain GET_CHAIN
                        get chain, one or many, e.g, A, but now also ABC works
  --fetch               fetch file from the PDB db, e.g., 1xjr,
                        use 'rp' to fetchthe RNA-Puzzles standardized_dataset [around 100 MB]
  --fetch-ba            fetch biological assembly from the PDB db
  --fetch-chain         fetch a structure in extract chain, e.g. 6bk8 H
  --get-seq             get seq
  --color-seq           color seq, works with --get-seq
  --ignore-files IGNORE_FILES
                        files to be ingored, .e.g, 'solution'
  --compact             with --get-seq, get it in compact view'
                        $ rna_pdb_toolsx.py --get-seq --compact *.pdb
                        # 20_Bujnicki_1
                        ACCCGCAAGGCCGACGGCGCCGCCGCUGGUGCAAGUCCAGCCACGCUUCGGCGUGGGCGCUCAUGGGU # A:1-68
                        # 20_Bujnicki_2
                        ACCCGCAAGGCCGACGGCGCCGCCGCUGGUGCAAGUCCAGCCACGCUUCGGCGUGGGCGCUCAUGGGU # A:1-68
                        # 20_Bujnicki_3
                        ACCCGCAAGGCCGACGGCGCCGCCGCUGGUGCAAGUCCAGCCACGCUUCGGCGUGGGCGCUCAUGGGU # A:1-68
                        # 20_Bujnicki_4

  --hide-warnings       hide warnings, works with --get-chain, it hides warnings that given changes are not detected in a PDB file
  --get-ss              get secondary structure
  --rosetta2generic     convert ROSETTA-like format to a generic pdb
  --no-hr               do not insert the header into files
  --renumber-residues   by defult is false
  --dont-rename-chains  used only with --get-rnapuzzle-ready.
                        By default:
                           --get-rnapuzzle-ready rename chains from ABC.. to stop behavior switch on this option
  --dont-fix-missing-atoms
                        used only with --get-rnapuzzle-ready
  --inspect             inspect missing atoms (technically decorator to --get-rnapuzzle-ready without actually doing anything but giving a report on problems)
  --collapsed-view
  --cv                  alias to collapsed_view
  -v, --verbose         tell me more what you're doing, please!
  --mutate MUTATE       mutate residues,
                        e.g.,
                              --mutate "A:1a+2a+3a+4a,B:1a"
                        to mutate to adenines the first four nucleotides of the chain A
                        and the first nucleotide of the chain B
  --edit EDIT           edit 'A:6>B:200', 'A:2-7>B:2-7'
  --rename-chain RENAME_CHAIN
                        edit 'A>B' to rename chain A to chain B
  --swap-chains SWAP_CHAINS
                        B>A, rename A to _, then B to A, then _ to B
  --set-chain SET_CHAIN
                        set chain for all ATOM lines and TER (quite brutal function)
  --replace-chain REPLACE_CHAIN
                        a file PDB name with one chain that will be used to
                        replace the chain in the original PDB file,
                        the chain id in this file has to be the same with the chain id of the original chain
  --delete DELETE       delete the selected fragment, e.g. A:10-16, or for more than one fragment --delete 'A:1-25+30-57'
  --extract EXTRACT     extract the selected fragment, e.g. A:10-16, or for more than one fragment --extract 'A:1-25+30-57'
  --extract-chain EXTRACT_CHAIN
                        extract chain, e.g. A
  --uniq UNIQ           
                        rna_pdb_toolsx.py --get-seq --uniq '[:5]' --compact --chain-first * | sort
                        A:1-121        ACCUUGCGCAACUGGCGAAUCCUGGGGCUGCCGCCGGCAGUACCC...CA # rp13nc3295_min.out.1
                        A:1-123        ACCUUGCGCGACUGGCGAAUCCUGAAGCUGCUUUGAGCGGCUUCG...AG # rp13cp0016_min.out.1
                        A:1-123        ACCUUGCGCGACUGGCGAAUCCUGAAGCUGCUUUGAGCGGCUUCG...AG # zcp_6537608a_ALL-000001_AA
                        A:1-45 57-71   GGGUCGUGACUGGCGAACAGGUGGGAAACCACCGGGGAGCGACCCGCCGCCCGCCUGGGC # solution
  --chain-first
  --oneline
  --replace-htm
  --fasta               with --get-seq, show sequences in fasta format,
                        can be combined with --compact (mind, chains will be separated with ' ' in one line)

                        $ rna_pdb_toolsx.py --get-seq --fasta --compact input/20_Bujnicki_1.pdb
                        > 20_Bujnicki_1
                        ACCCGCAAGGCCGACGGC GCCGCCGCUGGUGCAAGUCCAGCCACGCUUCGGCGUGGGCGCUCAUGGGU

  --cif2pdb             [PyMOL Python package required]
  --pdb2cif             [PyMOL Python package required]
  --mdr                 get structures ready for MD (like rpr but without first)

RNAPUZZLE-READY:
  --get-rnapuzzle-ready
                        get RNApuzzle ready (keep only standard atoms).'
                        Be default it does not renumber residues, use --renumber-residues
                        [requires BioPython]
  --rpr                 alias to get_rnapuzzle ready)

CAN BE COMBINED WITH:
  --keep-hetatm         keep hetatoms
  --inplace             in place edit the file! [experimental,
                        only for get_rnapuzzle_ready, --delete, --get-ss, --get-seq, --edit-pdb]
  --suffix SUFFIX       when used with --inplace allows you to change a name of a new file, --suffix del will give <file>_del.pdb (mind added _)
  --replace-hetatm      replace 'HETATM' with 'ATOM' [tested only with --get-rnapuzzle-ready]
  --dont-report-missing-atoms
                        used only with --get-rnapuzzle-ready
  --backbone-only       used only with --get-rnapuzzle-ready, keep only backbone (= remove bases)
  --no-backbone         used only with --get-rnapuzzle-ready, remove atoms of backbone (define as P OP1 OP2 O5')
  --bases-only          used only with --get-rnapuzzle-ready, keep only atoms of bases
```

Tricks:

    $ rna_pdb_toolsx.py --delete A:48-52 --suffix=noloop --inplace
    10_rp17c.out.14.pdb
    10_rp17c.out.14_out.pdb
    [..]

    $ rna_pdb_toolsx.py --get-rnapuzzle-ready --inplace *.pdb

.. keep original structures in original and use rpr:

    ➜  bujnicki_server_ss for i in original/*.pdb; do rna_pdb_toolsx.py --get-rnapuzzle-ready $i > ${i/.pdb/_rpr.pdb}; done
    ➜  bujnicki_server_ss ls
    17pz_withSS_all_thrs6.00A_clust01-000001_AA_rpr.pdb 17pz_withSS_all_thrs6.00A_clust06-000001_AA_rpr.pdb
    17pz_withSS_all_thrs6.00A_clust02-000001_AA_rpr.pdb 17pz_withSS_all_thrs6.00A_clust07-000001_AA_rpr.pdb
    17pz_withSS_all_thrs6.00A_clust03-000001_AA_rpr.pdb 17pz_withSS_all_thrs6.00A_clust08-000001_AA_rpr.pdb
    17pz_withSS_all_thrs6.00A_clust04-000001_AA_rpr.pdb 17pz_withSS_all_thrs6.00A_clust09-000001_AA_rpr.pdb
    17pz_withSS_all_thrs6.00A_clust05-000001_AA_rpr.pdb original

.. or to get structures ready for SimRNA/SimRNAweb use :

    $ for i in *pdb; do rna_pdb_toolsx.py --get-rnapuzzle-ready $i >  ${i/.pdb/_srr.pdb}; done
	# at some point there was a seperate function --get_simrna_ready but there is no need for it
	# simply use --get-rnapuzzle-ready 

rna-tools loves to be used with parallel (wirte in shell script what you want rna-tools to do) and run to execute it in a set of folders:

   parallel --bar --eta --progress 'cp test.sh {} && cd {} && bash test.sh ' ::: *

## Tools

The (almost) full list of tools can be found here: <https://github.com/mmagnus/rna-tools/blob/master/rna-tools-index.csv>

Read more http://rna-tools.readthedocs.io/en/latest/

## Docs

Read the documentations at [rna-tools.rtfd.io/en/latest/](http://rna-tools.rtfd.io/en/latest/).

<a href="http://rna-tools.rtfd.io/en/latest/"><img src="https://github.com/mmagnus/rna-tools/raw/master/docs/pngs/docs.png"></a>

## Cite

Magnus M, Antczak M, Zok T, Wiedemann J, Lukasiak P, Cao Y, Bujnicki JM, Westhof E, Szachniuk M, Miao Z. RNA-Puzzles toolkit: a computational resource of RNA 3D structure benchmark datasets, structure manipulation, and evaluation tools.  
Nucleic Acids Research. 2019  
10.1093/nar/gkz1108  
<https://academic.oup.com/nar/advance-article/doi/10.1093/nar/gkz1108/5651330>

## Used in papers
The papers in which the rna-tools package was used or one of spin-off projects, e.g., [RNA-Puzzles-Normalized-submissions](https://github.com/mmagnus/RNA-Puzzles-Standardized-Submissions/tree/master/rp17), [PyMOL4Spliceosome](https://github.com/mmagnus/PyMOL4Spliceosome):

[12] C. van der Feltz, B. Nikolai, C. Schneider, J. C. Paulson, X. Fu, and A. A. Hoskins, “Saccharomyces cerevisiaeEcm2 Modulates the Catalytic Steps of pre-mRNA Splicing,” bioRxiv, vol. 4, pp. 2132–45, Sep. 2020.

[11] T. Zhang, G. Hu, Y. Yang, J. Wang, and Y. Zhou, “All-Atom Knowledge-Based Potential for RNA Structure Discrimination Based on the Distance-Scaled Finite Ideal-Gas Reference State.,” J. Comput. Biol., vol. 27, no. 6, pp. 856–867, Jun. 2020.

[10] F. Stefaniak and J. M. Bujnicki, “AnnapuRNA: a scoring function for predicting RNA-small molecule interactions.,” biorxiv.org 2020 https://github.com/filipsPL/annapurna

[9]	G. Chojnowski, M. Magnus, and J. M. Bujnicki, “RNA fragment assembly with experimental restraints,” (in progress) Jun. 2020. http://iimcb.genesilico.pl/rnamasonry

[8]	A. M. Watkins, R. Rangan, and R. Das, “FARFAR2: Improved De Novo Rosetta Prediction of Complex Global RNA Folds.,” Structure, Jun. 2020.

[7] Z. Miao, R. W. Adamiak, M. Antczak, M. J. Boniecki, J. M. Bujnicki, S.-J. Chen, C. Y. Cheng, Y. Cheng, F.-C. Chou, R. Das, N. V. Dokholyan, F. Ding, C. Geniesse, Y. Jiang, A. Joshi, A. Krokhotin, M. Magnus, O. Mailhot, F. Major, T. H. Mann, P. Piatkowski, R. Pluta, M. Popenda, J. Sarzynska, L. Sun, M. Szachniuk, S. Tian, J. Wang, J. Wang, A. M. Watkins, J. Wiedemann, Y. Xiao, X. Xu, J. D. Yesselman, D. Zhang, Y. Zhang, Z. Zhang, C. Zhao, P. Zhao, Y. Zhou, T. Zok, A. Zyła, A. Ren, R. T. Batey, B. L. Golden, L. Huang, D. M. Lilley, Y. Liu, D. J. Patel, and E. Westhof, “RNA-Puzzles Round IV: 3D structure predictions of four ribozymes and two aptamers.,” RNA, p. rna.075341.120, May 2020.

[6] M. Magnus, K. Kappel, R. Das, and J. M. Bujnicki, “RNA 3D structure prediction guided by independent folding of homologous sequences.,” BMC Bioinformatics, vol. 20, no. 1, pp. 512–15, Oct. 2019. https://github.com/mmagnus/EvoClustRNA

[5] K. Eysmont, K. Matylla-Kulinska, A. Jaskulska, M. Magnus, and M. M. Konarska, “Rearrangements within the U6 snRNA Core during the Transition between the Two Catalytic Steps of Splicing.,” Molecular Cell, vol. 75, no. 3, pp. 538–548.e3, Aug. 2019. https://github.com/mmagnus/rna-tools/tree/master/U6MolCell

[4] J. Li, W. Zhu, J. Wang, W. Li, S. Gong, J. Zhang, and W. Wang, “RNA3DCNN: Local and global quality assessments of RNA 3D structures using 3D deep convolutional neural networks.,” PLoS Comput Biol, vol. 14, no. 11, p. e1006514, Nov. 2018. http://doi.org/10.1371/journal.pcbi.1006514

[3] P. Boccaletto, M. Magnus, C. Almeida, A. Zyła, A. Astha, R. Pluta, B. Bagiński, E. J. Jankowska, S. Dunin-Horkawicz, T. K. Wirecki, M. J. Boniecki, F. Stefaniak, and J. M. Bujnicki, “RNArchitecture: a database and a classification system of RNA families, with a focus on structural information.,” Nucleic Acids Research, vol. 46, no. 1, pp. D202–D205, Jan. 2018. https://iimcb.genesilico.pl/RNArchitecture/

[2] M. Magnus, M. J. Boniecki, W. K. Dawson, and J. M. Bujnicki, “SimRNAweb: a web server for RNA 3D structure modeling with optional restraints.,” Nucleic Acids Research, vol. 44, no. 1, pp. W315–9, Jul. 2016. https://iimcb.genesilico.pl/SimRNAweb/

[1] I. Tuszyńska, M. Magnus, K. Jonak, W. K. Dawson, and J. M. Bujnicki, “NPDock: a web server for protein-nucleic acid docking.,” Nucleic Acids Research, vol. 43, no. 1, pp. W425–30, Jul. 2015. http://iimcb.genesilico.pl/NPDock/

## RNA Puzzle Submission

Read at https://rna-tools.readthedocs.io/en/latest/rna-puzzles.html

## Inspiration (and alternatives)

+ https://www.rosettacommons.org/docs/latest/application_documentation/rna/RNA-tools
+ http://blue11.bch.msu.edu/mmtsb/convpdb.pl
+ https://github.com/haddocking/pdb-tools
+ https://github.com/harmslab/pdbtools
+ http://ginsberg.med.virginia.edu/Links/Phenix/pdbtools.htm
+ an amazing PDB fixer! https://github.com/openmm/pdbfixer
+ .. and more!

## Install

    pip install rna-tools

For developers see this http://rna-tools.readthedocs.io/en/latest/install-dev.html

## Index of tools

The index in a form of a searchable table can be found [here](https://github.com/mmagnus/rna-tools/blob/master/rna-tools-index.csv).

* [Index of tools](#index-of-tools)
  * [rna\_pdb\_toolsx\.py](#rna_pdb_toolsxpy)
  * [Sequence analysis](#sequence-analysis)
  * [Secondary structure analysis](#secondary-structure-analysis)
  * [Tertiary structure comparison](#tertiary-structure-comparison)
  * [Tertiary structure formats](#tertiary-structure-formats)
  * [Tertiary structure analysis](#tertiary-structure-analysis)
  * [Tertiary structure processing](#tertiary-structure-processing)
  * [PyMOL4RNA](#pymol4rna)
  * [SimRNA](#simrna)
  * [Rosetta](#rosetta)
  * [RNA Alignment](#rna-alignment)
  * [Python Classes](#python-classes)
  * [Other](#other)

<h3><a href="https://rna-tools.readthedocs.io/en/latest/main.html#rna-pdb-toolsx"><code>rna_pdb_toolsx.py</code></a></h3>

1. `--get-rnapuzzle-ready` format PDB file to be compatible with the "RNA-Puzzle PDB format",
1. `--report`             get report
1. `--renum-atoms`        renumber atoms, tested with --get-seq
1. `--renum-residues-dirty`
1. `--renumber-residues`  by defult is false
1. `--delete-anisou`      remove files with ANISOU records, works with --inplace
1. `--split-alt-locations`
1. `--clean`              get clean structure
1. `--is-pdb`             check if a file is in the pdb format
1. `--is-nmr`             check if a file is NMR-style multiple model pdb
1. `--un-nmr`             Split NMR-style multiple model pdb files into individual models [biopython]
1. `--orgmode`            get a structure in org-mode format <sick!>
1. `--get-chain GET_CHAIN`
1. `--fetch`              fetch file from the PDB db
1. `--fetch-ba`           fetch biological assembly from the PDB db
1. `--get-seq`            get seq
1. `--compact`            with --get-seq, get it in compact view'
1. `--get-ss`             get secondary structure
1. `--rosetta2generic`    convert ROSETTA-like format to a generic pdb
1. `--get-rnapuzzle-ready`
1. `--collapsed-view`
1. `--replace-hetatm`     replace 'HETATM' with 'ATOM' [tested only with --get-rnapuzzle-ready]
1. `--mutate MUTATE`      mutate residues,
1. `--edit EDIT`          edit 'A:6>B:200', 'A:2-7>B:2-7'
1. `--rename-chain RENAME_CHAIN`
1. `--swap-chains SWAP_CHAINS`
1. `--replace-chain REPLACE_CHAIN`
1. `--delete DELETE`      delete the selected fragment, e.g. A:10-16, or for more than one fragment --delete 'A:1-25+30-57'
1. `--extract EXTRACT`    extract the selected fragment, e.g. A:10-16, or for more than one fragment --extract 'A:1-25+30-57'
1. `--extract-chain EXTRACT_CHAIN`

### Sequence analysis

1. <a href="https://rna-tools.readthedocs.io/en/latest/tools.html#blast-pdb"><code>BlastPDB.py</code></a> - a simple Blast search,
1. <a href="https://rna-tools.readthedocs.io/en/latest/tools.html#rfam-search"><code>RfamSearch.py</code></a> - a simple Rfam search.

### Secondary structure analysis

1. <a href="https://rna-tools.readthedocs.io/en/latest/tools.html#module-rna_tools.Seq"><code>rna_secondary_structure_prediction.py</code></a> - a wrapper for secondary structure prediction methods, e.g., cyclefold, mcfold,ipknot, RNAsubopt, contextfold, centroid_fold, with a use of restraints (if applicable)
1. `rna_dot2ct.py` - convert dot notation to ct notation.
1. <a href="https://rna-tools.readthedocs.io/en/latest/tools.html#secondary-structure-format-conversion">secondary structure format conversion tools</a>

### Tertiary structure comparison

1. **`rna_calc_rmsd.py`** - calculate RMSDs of structures to the target
1. **`rna_calc_evo_rmsd.py`** - calculate RMSD between structures based on a given alignment and selected residues as defined in the "x line",
1. **`rna_calc_inf.py`** - including multiprocessing based on ClaRNA (in Python 2!)
1. **`rna_clanstix.py`** - a tool for visualizing RNA 3D structures based on pairwise structural similarity with Clans,
1. `rna_prediction_significance.py` - calculate significance of an RNA tertiary structure prediction.

### Tertiary structure formats

1. <a href="https://rna-tools.readthedocs.io/en/latest/tools.html#module-rna_tools.tools.diffpdb.diffpdb><code>diffpdb</code></a> - a simple tool to compare text-content of PDB files,

1. `rna_pdb_merge_into_one.py` - merge single files into an NMR-style multiple model file PDB file.

### Tertiary structure analysis
1. **`clarna_app.py`** - a wrapper to ClaRNA, See also PyMOL4RNA, Python 2!
1. **`rna_x3dna.py`** - a wrapper to 3dna, See also PyMOL4RNA,
1. `ClashCalc.py` - a simple clash score calculator, used in NPDock, requires BioPython,

### Tertiary structure processing
1. `rna_refinement.py` - a wrapper for QRNAS (Quick Refinement of Nucleic Acids)

### PyMOL4RNA

1. Undo ("Quick Save & Load") for PyMOL, `CTRL-S` & `CTRL-Z`,
1. [PyMOL4Spliceosome](https://github.com/mmagnus/PyMOL4Spliceosome) (link to its own repository)
1. `clarna()` - contact classification with ClaRNA directly in PyMOL for selected residues,
1. `x3dna()` - contact classification with X3DNA directly in PyMOL for selected residues,
1. `ss()` - get secondary structures of selected objects,
1.  `sav <fn>` - save on Desktop a session and a PNG file illustrating the session,
1. color structure domains according to pre-defined styles, e.g., `rp17()`
1. [PyMOL Preview Generator for OSX](https://github.com/mmagnus/rna-tools/tree/master/rna_tools/tools/pymol_preview_generator)

<h3><a target="_blank" href="https://rna-tools.readthedocs.io/en/latest/tools.html#simrna">SimRNA</a></h3>

1. `rna_simrna_cluster.py`
1. `rna_simrna_extract.py`
1. `rna_simrna_get_data`
1. `rna_simrna_lowest.py`
1. SimRNAweb: `rna_simrnaweb_download_job.py` - download model files, trajectory for a given SimRNAweb job
1. `rna_pdb_merge_structure_with_fragments.py` - insert fragments into the structure, used at the SimRNAweb server for modeling with a given pre-define structure,
1. `rna_pdb_edit_occupancy_bfactor.py` - edit occupancy or bfactor in PDB file,
1. `rna_pk_simrna_to_one_line.py` - convert multi-line SimRNA secondary structure format to one line bracket format,
1. `rna_ss_pk_to_simrna.py` - do opposite as previous one, convert one line bracket format with pseudoknots into multi-line SimRNA secondary structure format,
1. See also `simrna_trajectory` in Python Classes.

<h3><a target="_blank" href="https://rna-tools.readthedocs.io/en/latest/tools.html#rosetta">Rosetta</a></h3>

1. `rna_rosetta_n.py`
1. `rna_rosetta_check_progress.py`
1. `rna_rosetta_min.py`
1. `rna_rosetta_cluster.py`
1. `rna_rosetta_extract_lowscore_decoys.py`
1. `rna_rosetta_run.py`
1. `rna_rosetta_head.py`

### RNA Alignment

1. `get_seq()` - get sequence,
1. `get_ss()` - get secondary structure for a given sequence,
1. `fetch()` - fetch an alignment from Rfam,
1. `cmalign()` - aligns the RNA sequences in <seqfile> to the covariance model (CM) in <cmfile>
1. `Rchie()` - plotting arc diagrams of RNA secondary structures,
1. `find_core()` - finds core of molecules in alignment,

### Python Classes

1. `Seq.py` - seq processing, including secondary structure prediction
1. `SecondaryStructure.py::draw_ss()`
1. `SecondaryStructure.py::parse_vienna_to_pairs()`
1. `simrna_trajectory`

### Other

1. <a href="https://rna-tools.readthedocs.io/en/latest/tools.html#module-rna_tools.tools.rnakb_utils.rnakb_utils">rnakb_utils</a> - RNAkb-related tools,
1. rnapuzzle_sender - a script to send PDB files to the RNA-Puzzle organizers,
1. rnashape2ascii - convert RNA shape data into ascii characters ;-) `▅▄▆▄▂▁▁▁▁▁▁▁▁▁▁▂▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▂▅▇▅▄▃▂▁`
1. cluster_load - scripts to view cluster load, based on processing `qstat`.

## Index of Jupyters

- https://github.com/mmagnus/rna-tools/blob/master/notes/fig3-manuscript.ipynb
- https://github.com/mmagnus/rna-tools/blob/master/rna_tools/tools/rna_alignment/rna_alignment.ipynb
## References
Components of rna-tools are based upon the following pieces of scientific literature:

P. J. A. Cock, T. Antao, J. T. Chang, B. A. Chapman, C. J. Cox, A. Dalke, I. Friedberg, T. Hamelryck, F. Kauff, B. Wilczynski, and M. J. L. de Hoon, “Biopython: freely available Python tools for computational molecular biology and bioinformatics.,” Bioinformatics, vol. 25, no. 11, pp. 1422–1423, Jun. 2009.

M. Rother, K. M. Rother, T. Puton, and J. M. Bujnicki, “ModeRNA: a tool for comparative modeling of RNA 3D structure.,” Nucleic Acids Research, vol. 39, no. 10, pp. 4007–4022, May 2011.

T. Waleń, G. Chojnowski, P. Gierski, and J. M. Bujnicki, “ClaRNA: a classifier of contacts in RNA 3D structures ased on a comparative analysis of various classification schemes.,” Nucleic Acids Research, vol. 42, no. 19, pp. e151–e151, Oct. 2014.

and more, see seperate readmes.


