Metadata-Version: 2.1
Name: pydna
Version: 5.2.0a4
Summary: Representing double stranded DNA and functions for simulating cloning and homologous recombination between DNA molecules.
License: BSD
Author: BjornFJohansson
Author-email: bjornjobb@gmail.com
Requires-Python: >=3.7,<4.0
Classifier: License :: Other/Proprietary License
Classifier: Programming Language :: Python :: 3
Classifier: Programming Language :: Python :: 3.7
Classifier: Programming Language :: Python :: 3.8
Classifier: Programming Language :: Python :: 3.9
Classifier: Programming Language :: Python :: 3.10
Classifier: Programming Language :: Python :: 3.11
Requires-Dist: appdirs (>=1.4.4,<2.0.0)
Requires-Dist: biopython (>=1.80,<2.0)
Requires-Dist: networkx (>=2.8.8,<3.0.0)
Requires-Dist: prettytable (>=3.5.0,<4.0.0)
Requires-Dist: pyfiglet (>=0.8.post1,<0.9)
Requires-Dist: pyperclip (>=1.8.2,<2.0.0)
Description-Content-Type: text/markdown

# ![icon](https://raw.githubusercontent.com/bjornFJohansson/pydna/master/docs/pics/pydna.resized.png) pydna

| [![Tests & Coverage](https://github.com/BjornFJohansson/pydna/workflows/Tests%20&%20Coverage/badge.svg)](https://github.com/BjornFJohansson/pydna/actions?query=workflow%3A%22Tests+%26+Coverage%22)                |[![codecov](https://codecov.io/gh/BjornFJohansson/pydna/branch/master/graph/badge.svg)](https://codecov.io/gh/BjornFJohansson/pydna/branch/master)    | [![PyPI version](https://badge.fury.io/py/pydna.svg)](https://badge.fury.io/py/pydna)                                                   |[![Anaconda-Server Badge](https://anaconda.org/bjornfjohansson/pydna/badges/version.svg)](https://anaconda.org/bjornfjohansson/pydna)   | [![Google group : pydna](https://img.shields.io/badge/Google%20Group-pydna-blue.svg)](https://groups.google.com/g/pydna)        |
|---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------|------------------------------------------------------------------------------------------------------------------------------------------------------|-----------------------------------------------------------------------------------------------------------------------------------------|----------------------------------------------------------------------------------------------------------------------------------------|---------------------------------------------------------------------------------------------------------------------------------|
| [![Documentation Status](https://readthedocs.org/projects/pydna/badge/?version=latest)](http://pydna.readthedocs.io/?badge=latest)                                                                                  |[![GitHub issues](https://img.shields.io/github/issues/BjornFJohansson/pydna.svg)](https://github.com/BjornFJohansson/pydna/issues)                   | [![Anaconda-Server Badge2](https://anaconda.org/bjornfjohansson/pydna/badges/license.svg)](https://anaconda.org/bjornfjohansson/pydna)  |[![GitHub stars](https://img.shields.io/github/stars/BjornFJohansson/pydna.svg)](https://github.com/BjornFJohansson/pydna/stargazers)   |                                                                                                                                 |


Planning genetic constructs with many parts and assembly steps, such as recombinant
metabolic pathways :petri_dish:, are often difficult to **properly** document as is evident from the
state of such documentation in the scientific literature :radioactive:.


The pydna python package provide a human-readable formal descriptions of :dna: cloning and genetic assembly
strategies in Python :snake: which allow for simulation and verification.


Pydna can perhaps be thought of as [executable documentation](https://en.wikipedia.org/wiki/Literate_programming) for cloning.


A cloning strategy expressed in pydna is **complete**, **unambiguous** and **stable**.


Pydna provides simulation of:

- Restriction digestion
- Ligation
- PCR
- Primer design
- Gibson assembly
- Golden gate assembly
- Homologous recombination
- Gel electrophoresis of DNA with generation of gel images

Virtually any sub-cloning experiment can be described in pydna, and its execution yield
the sequences of intermediate and final DNA molecules.

Pydna has been designed to be understandable for biologists with only some basic understanding of Python.

Pydna can formalize planning and sharing of cloning strategies and is especially useful for complex or combinatorial
DNA molecule constructions.


To get started, we have compiled some [simple examples](https://github.com/MetabolicEngineeringGroupCBMA/pydna-examples#pydna-examples).
For more elaborate use, look at some assembly strategies of D-xylose metabolic pathways [MetabolicEngineeringGroupCBMA/ypk-xylose-pathways](https://github.com/MetabolicEngineeringGroupCBMA/ypk-xylose-pathways#pereira-et-al-2016).


There is an open access paper in BMC Bioinformatics describing pydna:

[![abstr](https://raw.githubusercontent.com/bjornFJohansson/pydna/master/docs/pics/BMC_resized.png)](http://www.biomedcentral.com/1471-2105/16/142/abstract)

Please reference the above paper:


Pereira, F., Azevedo, F., Carvalho, Â., Ribeiro, G. F., Budde, M. W., & Johansson, B. (2015). Pydna: a simulation and documentation tool for DNA assembly strategies using python. BMC Bioinformatics, 16(142), 142.


if using pydna in a scientific publication.


![-----------------------------------------------------](https://raw.githubusercontent.com/andreasbm/readme/master/assets/lines/colored.png)



## Usage

Most pydna functionality is implemented as methods for the double stranded DNA sequence record
classes Dseq and Dseqrecord, which are subclasses of the [Biopython](http://biopython.org/wiki/Main_Page) [Seq](http://biopython.org/wiki/Seq) and [SeqRecord](http://biopython.org/wiki/SeqRecord) classes.

These classes make cut and paste cloning and PCR very simple:


    >>> from pydna.dseq import Dseq
    >>> seq = Dseq("GGATCCAAA","TTTGGATCC",ovhg=0)
    >>> seq
    Dseq(-9)
    GGATCCAAA
    CCTAGGTTT
    >>> from Bio.Restriction import BamHI
    >>> a,b = seq.cut(BamHI)
    >>> a
    Dseq(-5)
    G
    CCTAG
    >>> b
    Dseq(-8)
    GATCCAAA
        GTTT
    >>> a+b
    Dseq(-9)
    GGATCCAAA
    CCTAGGTTT
    >>> b+a
    Dseq(-13)
    GATCCAAAG
        GTTTCCTAG
    >>> b+a+b
    Dseq(-17)
    GATCCAAAGGATCCAAA
        GTTTCCTAGGTTT
    >>> b+a+a
    Traceback (most recent call last):
      File "<stdin>", line 1, in <module>
      File "/usr/local/lib/python2.7/dist-packages/pydna/dsdna.py", line 217, in __add__
        raise TypeError("sticky ends not compatible!")
    TypeError: sticky ends not compatible!
    >>>

As the example above shows, pydna keeps track of sticky ends.

Notably, homologous recombination and Gibson assembly between linear DNA fragments
can be easily simulated without any additional information besides the primary sequence of the fragments.

Gel electrophoresis of DNA fragments can be simulated using the included gel module


    Jupyter QtConsole 4.7.7
    Python 3.8.5 | packaged by conda-forge | (default, Aug 29 2020, 01:22:49)
    Type 'copyright', 'credits' or 'license' for more information
    IPython 7.18.1 -- An enhanced Interactive Python. Type '?' for help.

    In [1]: from pydna.gel import gel

    In [2]: from pydna.ladders import PennStateLadder

    In [3]: from pydna.dseqrecord import Dseqrecord

    In [4]: gel([PennStateLadder,[Dseqrecord("A"*2000)]])
    Out[4]:



![](https://raw.githubusercontent.com/BjornFJohansson/pydna/master/scripts/pydna_gel.png)


Pydna can be very compact. The eleven lines of Python below simulates the construction of a recombinant plasmid.
DNA sequences are downloaded from Genbank by accession numbers that are guaranteed to be stable over time.

    from pydna.genbank import Genbank
    gb = Genbank("myself@email.com") # Tell Genbank who you are!
    gene = gb.nucleotide("X06997") # Kluyveromyces lactis LAC12 gene for lactose permease.
    from pydna.parsers import parse_primers
    primer_f,primer_r = parse_primers(''' >760_KlLAC12_rv (20-mer)
                                          ttaaacagattctgcctctg

                                          >759_KlLAC12_fw (19-mer)
                                          aaatggcagatcattcgag ''')
    from pydna.amplify import pcr
    pcr_prod = pcr(primer_f,primer_r, gene)
    vector = gb.nucleotide("AJ001614") # pCAPs cloning vector
    from Bio.Restriction import EcoRV
    lin_vector = vector.linearize(EcoRV)
    rec_vec =  ( lin_vector + pcr_prod ).looped()

Pydna can automate the simulation of [sub cloning](http://en.wikipedia.org/wiki/Subcloning) experiments using
python. This is helpful to generate examples for teaching purposes.

Read the documentation (below) or the [cookbook](https://github.com/BjornFJohansson/pydna/blob/master/docs/cookbook/cookbook.ipynb) with example files
for further information.

Please post a message in the [google group](https://groups.google.com/d/forum/pydna)
for pydna if you need help or have problems, questions or comments :sos:.

Feedback & suggestions are very welcome!

![-----------------------------------------------------](https://raw.githubusercontent.com/andreasbm/readme/master/assets/lines/colored.png)


## Who is using pydna?

Taylor, L. J., & Strebel, K. (2017).
Pyviko: an automated Python tool to design gene knockouts in complex viruses with overlapping genes.
BMC Microbiology, 17(1), 12.
[PubMed](https://www.ncbi.nlm.nih.gov/pubmed/28061810)


Wang, Y., Xue, H., Pourcel, C., Du, Y., & Gautheret, D. (2021).
2-kupl: mapping-free variant detection from DNA-seq data of matched samples.
In Cold Spring Harbor Laboratory (p. 2021.01.17.427048). [DOI](https://doi.org/10.1101/2021.01.17.427048)
[PubMed](https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8180056)


[An Automated Protein Synthesis Pipeline with Transcriptic and Snakemake](http://blog.booleanbiotech.com/transcriptic_protein_synthesis_pipeline.html)


and other projects on [github](https://github.com/BjornFJohansson/pydna/network/dependents?package_id=UGFja2FnZS01MjQ2MjYzNQ%3D%3D)



![-----------------------------------------------------](https://raw.githubusercontent.com/andreasbm/readme/master/assets/lines/colored.png)

## Documentation

Documentation is built using [Sphinx](http://www.sphinx-doc.org/) from [docstrings](https://www.python.org/dev/peps/pep-0257/)
in the code and displayed at readthedocs [![Documentation Status](https://readthedocs.org/projects/pydna/badge/?version=latest)](http://pydna.readthedocs.io/?badge=latest)

The [numpy](www.numpy.org) [docstring format](https://github.com/numpy/numpy/blob/release/doc/HOWTO_DOCUMENT.rst.txt) is used.

![-----------------------------------------------------](https://raw.githubusercontent.com/andreasbm/readme/master/assets/lines/colored.png)

## Installation using conda

The absolutely best way of installing and using pydna is to use the
free [Anaconda](https://store.continuum.io/cshop/anaconda) or [Miniconda](http://conda.pydata.org/miniconda.html)
python distributions.

Anaconda is a large download (about 600-700 Mb) while Miniconda is about 70-80 Mb.

Once Anaconda (or Miniconda) is installed, the conda package manager can be used to install pydna.

Type the command below followed by return:

    conda install -c conda-forge -c defaults -c BjornFJohansson pydna

The command above pulls packages from the software channels `conda-forge` and `defaults`.
The pydna package itself is present in the `BjornFJohansson` channel.

This works on Windows, MacOSX and Linux, and installs all necessary and optional dependencies
automatically (see below).

The conda install command will install the latest version, even if this is an alpha version.

Older versions of pydna are available from the [BjornFJohansson](https://anaconda.org/bjornfjohansson) package channel.

![-----------------------------------------------------](https://raw.githubusercontent.com/andreasbm/readme/master/assets/lines/colored.png)

## Installation using pip

The second best way of installing pydna is with pip, the
officially [recommended](http://python-packaging-user-guide.readthedocs.org/en/latest) tool.

Pip is included in recent Python versions.

Pip installs the minimal installation requirements automatically, but not the optional requirements (see below).

    sudo pip install pydna --pre

Use the --pre switch to get the latest version of pydna.

### Windows:

You should be able to pip install pydna from the Windows terminal as biopython now can be installed with pip as well.

    C:\> pip install pydna --pre

By default python and pip are not on the PATH. You can re-install Python and select this option during installation,
or give the full path for pip. Try something like this, depending on where your copy of Python is installed:

    C:\Python37\Scripts\pip install pydna --pre


### Installing requirements

If you want to install requirements before installing pydna, you can do:

	pip install -r requirements.txt

And for the optional requirements:

	pip install -r requirements_optional.txt

For testing:

	pip install -r requirements_test.txt

or

	conda install --file requirements.txt


![-----------------------------------------------------](https://raw.githubusercontent.com/andreasbm/readme/master/assets/lines/colored.png)

## Installation from Source

If you install from source, you need to install all dependencies separately (listed above).
Download one of the source installers from the pypi site or from Github and extract the file.
Open the pydna source code directory (containing the setup.py file) in
terminal and type:

    python setup.py install

![-----------------------------------------------------](https://raw.githubusercontent.com/andreasbm/readme/master/assets/lines/colored.png)

## Source Code

Pydna is developed on [Github](https://github.com/BjornFJohansson/pydna) :octocat:.

![-----------------------------------------------------](https://raw.githubusercontent.com/andreasbm/readme/master/assets/lines/colored.png)

## Minimal installation dependencies

Pydna versions before 1.0.0 were compatible with python 2.7 only.
The list below is the minimal requirements for installing pydna.
Biopython has c-extensions, but the other modules are pure python.

- [Python 3.7, 3.8, 3.9, 3.10 or 3.11](http://www.python.org)
- [appdirs >= 1.3.0](https://pypi.python.org/pypi/appdirs)
- [biopython >= 1.80](http://pypi.python.org/pypi/biopython)
- [networkx >= 1.8.1](http://pypi.python.org/pypi/networkx)
- [prettytable >= 0.7.2](https://pypi.python.org/pypi/PrettyTable)

![-----------------------------------------------------](https://raw.githubusercontent.com/andreasbm/readme/master/assets/lines/colored.png)

## Optional dependencies

If the modules listed below in the first column are installed, they will provide the functionality
listed in the second column.

| Dependency                                          | Function in pydna                                      |
|-----------------------------------------------------|--------------------------------------------------------|
| [pyparsing](https://pypi.python.org/pypi/pyparsing) | fix corrupt Genbank files with pydna.genbankfixer      |
| [requests](https://pypi.org/project/requests)       | download sequences with pydna.download                 |
| [CAI](https://pypi.org/project/CAI)                 | codon adaptation index calculations in several modules |
| [numpy](http://www.numpy.org)                       | gel simulation with pydna.gel                          |
| [scipy](https://www.scipy.org)                      | “                                                      |
| [matplotlib](http://matplotlib.org)                 | “                                                      |
| [pillow](https://github.com/python-pillow/Pillow)   | “                                                      |

![-----------------------------------------------------](https://raw.githubusercontent.com/andreasbm/readme/master/assets/lines/colored.png)

## Requirements for running tests and analyzing code coverage

- [pytest](https://pypi.org/project/pytest)
- [pytest-cov](https://pypi.org/project/pytest-cov)
- [pytest-mock](https://pypi.org/project/pytest-mock)
- [pytest-doctestplus](https://pypi.org/project/pytest-doctestplus)
- [coverage](https://pypi.org/project/coverage)
- [nbval](https://pypi.org/project/nbval)
- [requests-mock](https://pypi.org/project/requests-mock)



![-----------------------------------------------------](https://raw.githubusercontent.com/andreasbm/readme/master/assets/lines/colored.png)

## Changelog

See the [change log](docs/CHANGELOG.md) for recent changes.

![-----------------------------------------------------](https://raw.githubusercontent.com/andreasbm/readme/master/assets/lines/colored.png)

## Automatic testing & Release process

There are three github actions associated with this package:

- `pydna_test_and_coverage_workflow.yml`
- `pydna_setuptools_build_workflow.yml`
- `pydna_conda_build_workflow.yml`

The `pydna_test_and_coverage_workflow.yml` is triggered on all pushed non-tagged commits.
This workflow run tests, doctests and a series of Jupyter notebooks using pytest.

The two other workflows build a setuptools wheel and packages for different Python versions
on Linux, Windows and macOS.

These are triggered by publishing a github release manually from the github interface.


## Building a setuptools package


	poetry build # run this command in the root directory where the pyproject.toml file is located


Pydna uses the poetry plugin []()


	twine upload dist/pydna-5.1a6-py3-none-any.whl  # The exact name depends on the version set as git tagged



## Building a conda package



### History

Pydna was made public in 2012 on [Google code](https://code.google.com/archive/p/pydna).


:microbe:


:portugal:

