Metadata-Version: 2.1
Name: primers
Version: 0.2.3
Summary: Create PCR primers optimized for length, tm, gc and free energy
Home-page: https://github.com/Lattice-Automation/primers
Author: JJTimmons
Author-email: jtimmons@latticeautomation.com
License: mit
Description: # primers
        
        This is a tool for making PCR primers for DNA sequences. `primers`' emphasis is on ease-of-use and DNA assembly. Adding additional sequence to 5' end of the FWD and REV primer is easy with `primers`. This is a common requirement for Gibson assembly and Golden Gate cloning. Finally, it has a permissive MIT license where other primer design tools, like Primer3, don't.
        
        ## Installation
        
        ```bash
        pip install primers
        ```
        
        ## Usage
        
        ### Python
        
        ```python
        from primers import primers
        
        # add enzyme recognition sequences to FWD and REV primers: BsaI, BpiI
        fwd, rev = primers("AATGAGACAATAGCACACACAGCTAGGTCAGCATACGAAA", add_fwd="GGTCTC" add_rev="GAAGAC")
        print(fwd.fwd)  # True
        print(fwd.seq)  # GGTCTCAATGAGACAATAGCACACACA; 5' to 3'
        print(fwd.tm)   # 62.4; melting temp
        print(fwd.tm_total)  # 68.6; melting temp with added seq (GGTCTC)
        print(fwd.dg)   # -1.86; minimum free energy of the secondary structure
        
        # add from a range of sequence to the FWD primer: [5, 12] bp
        add_fwd = "GGATCGAGCTTGA"
        fwd, rev = primers("AATGAGACAATAGCACACACAGCTAGGTCAGCATACGAAA", add_fwd=add_fwd, add_fwd_len=(5, 12))
        print(fwd.seq)  # AGCTTGAAATGAGACAATAGCACACACAGC
        print(fwd.tm)   # 62.2
        print(fwd.tm_total)  # 70.0
        ```
        
        ### CLI
        
        ```txt
        $ primers AATGAGACAATAGCACACACAGCTAGGTCAGCATACGAAA -f GGTCTC -r GAAGAC
          dir    tm   ttm     dg   pen  seq
          FWD  62.4  68.6  -1.86  5.43  GGTCTCAATGAGACAATAGCACACACA
          REV  62.8  67.4      0   4.8  GAAGACTTTCGTATGCTGACCTAG
        ```
        
        ```txt
        $ primers --help
        usage: primers [-h] [-f SEQ] [-fl INT INT] [-r SEQ] [-rl INT INT] [-t SEQ] [--version] SEQ
        
        Create PCR primers for a DNA sequence.
        
        Logs the FWD and REV primer with columns:
            dir, tm, ttm, dg, pen, seq
        
        Where:
            dir = FWD or REV.
            tm  = Melting temperature of the annealing/binding part of the primer (Celsius).
            ttm = The total melting temperature of the primer with added seq (Celsius).
            dg  = The minimum free energy of the primer's secondary structure (kcal/mol).
            pen = The primer's penalty score. Lower is better.
            seq = The sequence of the primer in the 5' to the 3' direction.
        
        positional arguments:
          SEQ          DNA sequence
        
        optional arguments:
          -h, --help   show this help message and exit
          -f SEQ       additional sequence to add to FWD primer (5' to 3')
          -fl INT INT  space separated min-max range for the length to add from '-f' (5' to 3')
          -r SEQ       additional sequence to add to REV primer (5' to 3')
          -rl INT INT  space separated min-max range for the length to add from '-r' (5' to 3')
          -t SEQ       sequence to check for offtargets binding sites
          --version    show program's version number and exit
        ```
        
        ## Overview
        
        Creating primers for a DNA sequence is non-trivial because it's multi-objective optimization. Ideally pairs of primers for PCR amplification would have similar tms, GC ratios close to 0.5, high minimum free energies (dg), and a lack off-target binding sites. In `primers`, like Primer3, this is accomplished with a formula in which undesired primer characteristics are penalized. The primer pair with the lowest penalty score is created.
        
        ### Scoring
        
        The penalty for each possible primer, p, is calculated as:
        
        ```txt
        PENALTY(p) =
            abs(p.tm - opt_tm) * penalty_tm +
            abs(p.gc - opt_gc) * penalty_gc +
            abs(len(p) - opt_len) * penalty_len +
            abs(p.tm - p.pair.tm) * penalty_tm_diff +
            abs(p.dg) * penalty_dg +
            p.offtargets * penalty_offtarget
        ```
        
        Each of the optimal (`opt_*`) and penalty (`penalty_*`) parameters is adjustable through the `primers.primers()` function. The defaults are below.
        
        ```python
        opt_tm: float = 62.0
        opt_gc: float = 0.5
        opt_len: int = 22
        penalty_tm: float = 1.0
        penalty_gc: float = 3.0
        penalty_len: float = 1.0
        penalty_tm_diff: float = 1.0
        penalty_dg: float = 2.0
        penalty_offtarget: float = 20.0
        ```
        
        ### Offtargets
        
        Offtargets are defined as a subsequence within one mismatch of the last 10bp of a primer's 3' end. This is experimentally supported by:
        
        > Wu, J. H., Hong, P. Y., & Liu, W. T. (2009). Quantitative effects of position and type of single mismatch on single base primer extension. Journal of microbiological methods, 77(3), 267-275
        
        By default, primers are checked for offtargets within the `seq` parameter passed to `primers.primers(seq)`. But the primers can be checked against another sequence if it's passed through the `offtarget_check` argument. This is useful when PCR'ing a subsequence of a larger DNA sequence; for example: a plasmid.
        
        ```python
        seq = "AATGAGACAATAGCACACACAGCTAGGTCAGCATACGAAA"
        parent = "ggaattacgtAATGAGACAATAGCACACACAGCTAGGTCAGCATACGAAAggaccagttacagga"
        
        # primers are checked for offtargets in `parent`
        fwd, rev = primers(seq, offtarget_check=parent)
        ```
        
Platform: UNKNOWN
Classifier: Development Status :: 3 - Alpha
Classifier: Programming Language :: Python :: 3 :: Only
Classifier: Topic :: Scientific/Engineering :: Bio-Informatics
Classifier: Environment :: Console
Requires-Python: >=3.0
Description-Content-Type: text/markdown
