Metadata-Version: 2.1
Name: primerJinn
Version: 1.0.0.dev25
Summary: In silico PCR tool
Home-page: https://github.com/SemiQuant/primerJinn
Author: Jason D Limberis
Author-email: Jason.Limberis@ucsf.edu
License: MIT
Keywords: PCR,in silico PCR
Classifier: Programming Language :: Python :: 3
Classifier: License :: OSI Approved :: MIT License
Classifier: Operating System :: OS Independent
Description-Content-Type: text/markdown

<div>
    <img src="https://user-images.githubusercontent.com/8179171/236663567-94d1f5dc-2ac6-49de-9fc1-a99c7a13945d.png" width="20%" height="20%">
    <p>primerJinn has two main functions, it designs primers for a multiplex PCR of given target regions of a DNA sequence in a FASTA file and it performs in silico PCR given a list of primers and a reference FASTA file.</p>
</div>

<!-- [![DOI](https://zenodo.org/badge/DOI/10.5281/zenodo.7903629.svg)](https://doi.org/10.5281/zenodo.7903629) -->


The scripts takes several arguments:

| **Program**       | **Required** | **Parameter**      | **Description**                                                                                                                                                           | **Default**                             |
|-------------------|--------------|--------------------|---------------------------------------------------------------------------------------------------------------------------------------------------------------------------|-----------------------------------------|
| **Both**          | Y            | input_file         | The path to the input FASTA file.                                                                                                                                         | NA                                      |
| **primer design** | Y            | region_file        | The path to the primer design region file. This file should have three columns: name, start position, and end position (1-based). It can be in either tsv or xlxs format. | NA                                      |
| **Both**          | N            | salt_concentration | Salt concentration (in nM, Ignored if Q5 True).                                                                                                                           | 50                                      |
| **Both**          | N            | target_tm          | The desired melting temperature (Tm) for the primers                                                                                                                      | 60C                                     |
| **Both**          | N            | output             | The name of the output file.                                                                                                                                              | 'MultiPlexPrimerSet' or 'in_silico_PCR' |
| **primer design** | N            | primer_len         | The desired length of the primers.                                                                                                                                        | 20                                      |
| **primer design** | N            | product_size_min   | The desired min size for the PCR product.                                                                                                                                 | 400                                     |
| **primer design** | N            | product_size_max   | The desired max size for the PCR product.                                                                                                                                 | 800                                     |
| **primer design** | N            | ret                | The maximum number of primer pairs to return                                                                                                                              | 100                                     |
| **primer design** | N            | Q5                 | A boolean indicating whether to use NEB Q5 hotstart polymerase settings for primer3                                                                                       | TRUE                                    |
| **primer design** | N            | background         | The path to the mispriming library FASTA file                                                                                                                             |                                         |
| **primer design** | N            | ill_adapt         | Add Illumina partial adapters                                                                                                                              | FALSE                                         |
| **primer design** | N            | clamp         | Require GC clamp                                                                                                                               | 0                                         |
| **primer design** | N            | poly         | Maximum allowable length of a mononucleotide repeat (poly-X) in the primer sequence                                                                                                                               | 3                                         |
| **in silico PCR** | N            | product_size_max   | Maximum length of PCR products in nucleotides.                                                                                                                            | 2000                                    |
| **in silico PCR** | N            | req_five           | Require the 5' end of the primer to bind?                                                                                                                                 | TRUE                                    |


### Dependencies

-   Python 3
-   [BLAST+](https://www.ncbi.nlm.nih.gov/books/NBK569861/)

### Installation

```
pip install primerJinn
```

### Multiplex primer generation example usage

```
getMultiPrimerSet \
    --region_file "./example/primer_regions.tsv" \
    --input_file "./example/ref.fasta" \
    --target_tm 65 \
    --primer_len 20 \
    --product_size_min 400 \
    --product_size_max 800 \
    --ret 100 \
    --Q5 \
    --background "" \
    --output "example"
```

###MultiPlexPrimerSet.xlxs

| Forward Primer       | Reverse Primer       | Forward tm | Reverse tm | Product Size | Name                   | Forward Primer TM NEB | Reverse Primer TM NEB |
|----------------------|----------------------|------------|------------|--------------|------------------------|-----------------------|-----------------------|
| GAGGAACACCACTAGTACCG | CTCGATGACTTTACGGCCAT | 65.08334   | 64.69482   | 675          | Target 1461045-1461291 | 64                    | 64                    |
| CATGGGATATGGAGCGATCG | GGGGTCGTAGGAGATCTTGA | 65.95586   | 65.59987   | 791          | Target 490900-491416   | 65                    | 65                    |
| CCGGTTGTCCATTCCGTTTA | CTGTACGTATTTGGGTTGCG | 64.17967   | 65.57867   | 454          | Target 1303831-1303911 | 65                    | 64                    |
| GGATGCGAGCTATATCTCCG | AATACGCCGAGATGTGGATG | 65.15669   | 64.9819    | 458          | Target 1674182-1674222 | 65                    | 65                    |
| CAACAGTTCATCCCGGTTCG | GACGGATTTGTCGCTCACTA | 64.88889   | 66.57304   | 759          | Target 2288681-2289242 | 66                    | 64                    |
| GCCACCATCGAATATCTGGT | GCTCCAGGAAGGGAATCATC | 65.63736   | 65.01728   | 778          | Target 761007-761277   | 64                    | 65                    |
| GCATACCGAACGTCACAGAT | ACGGTCACCTACAAAAACGG | 65.68941   | 65.23466   | 665          | Target 778990-779488   | 65                    | 65                    |
| GCTCTTAAGGCTGGCAATCT | CGGTCACACTTTCGGTAAGA | 64.82047   | 65.53067   | 577          | Target 2154831-2154873 | 65                    | 64                    |


### PCR in silico example usage

```
PCRinSilico \
   --primer_seq ./example/primers.txt \
   --target_tm 50 \
   --input_file ./example/ref.fasta
```

#### in_silico_PCR.tsv
| qseq1 | qseq1_input          | qstart1 | qend1 | direction1 | mismatch1 | qseq2 | qseq2_input          | qstart2 | qend2 | direction2 | mismatch2 | binding_pos_diff | reference   | ref_region |         |
|-------|----------------------|---------|-------|------------|-----------|-------|----------------------|---------|-------|------------|-----------|------------------|-------------|------------|---------|
| p1    | GAGGAACACCACTAGTACCG | 1       | 20    | +          | 0         | p9    | CTCGATGACTTTACGGCCAT | 1       | 20    | -          | 0         | 655              | NC_000962.3 | 1461637    | 1460982 |
| p2    | CATGGGATATGGAGCGATCG | 1       | 20    | +          | 0         | p10   | GGGGTCGTAGGAGATCTTGA | 1       | 20    | -          | 0         | 771              | NC_000962.3 | 491474     | 490703  |
| p3    | CCGGTTGTCCATTCCGTTTA | 1       | 20    | +          | 0         | p11   | CTGTACGTATTTGGGTTGCG | 1       | 20    | -          | 0         | 434              | NC_000962.3 | 1304111    | 1303677 |
| p4    | GGATGCGAGCTATATCTCCG | 1       | 20    | +          | 0         | p12   | AATACGCCGAGATGTGGATG | 1       | 20    | -          | 0         | 438              | NC_000962.3 | 1674558    | 1674120 |
| p5    | CAACAGTTCATCCCGGTTCG | 1       | 20    | +          | 0         | p13   | GACGGATTTGTCGCTCACTA | 1       | 20    | -          | 0         | 739              | NC_000962.3 | 2289391    | 2288652 |
| p6    | GCCACCATCGAATATCTGGT | 1       | 20    | +          | 0         | p14   | GCTCCAGGAAGGGAATCATC | 1       | 20    | -          | 0         | 758              | NC_000962.3 | 761564     | 760806  |
| p7    | GCATACCGAACGTCACAGAT | 1       | 20    | +          | 0         | p15   | ACGGTCACCTACAAAAACGG | 1       | 20    | -          | 0         | 645              | NC_000962.3 | 779595     | 778950  |
| p8    | GCTCTTAAGGCTGGCAATCT | 1       | 20    | +          | 0         | p16   | CGGTCACACTTTCGGTAAGA | 1       | 20    | -          | 0         | 557              | NC_000962.3 | 2155289    | 2154732 |


#### in_silico_PCR_amplicon_interactions.tsv
| amplicon1_PF | amplicon1_PR | amplicon2_PF | amplicon2_PR | tm          |
|--------------|--------------|--------------|--------------|-------------|
| kkd_F_2      | sge_R        | kkd_R        | sge_R        | 90.22726832 |


#### in_silico_PCR_primer_dimears.tsv
| Sequence1 | Sequence2 | MeltingTemp |
|-----------|-----------|-------------|
| p1        | p2        | 73          |
| p1        | p3        | 74          |
| p1        | p4        | 73          |
| p1        | p5        | 73          |
| p1        | p6        | 73          |
| p1        | p7        | 72          |
| p1        | p8        | 73          |
| p1        | p9        | 73          |
| p1        | p10       | 74          |
