3UTRBERT
Pre-trained model on 3’ untranslated region (3’UTR) using a masked language modeling (MLM) objective.
Disclaimer
This is an UNOFFICIAL implementation of the Deciphering 3’ UTR mediated gene regulation using interpretable deep representation learning by Yuning Yang, Gen Li, et al.
The OFFICIAL repository of 3UTRBERT is at yangyn533/3UTRBERT.
Tip
The MultiMolecule team has confirmed that the provided model and checkpoints are producing the same intermediate representations as the original implementation.
The team releasing 3UTRBERT did not write this model card for this model so this model card has been written by the MultiMolecule team.
Model Details
3UTRBERT is a bert-style model pre-trained on a large corpus of 3’ untranslated regions (3’UTRs) in a self-supervised fashion. This means that the model was trained on the raw nucleotides of RNA sequences only, with an automatic process to generate inputs and labels from those texts. Please refer to the Training Details section for more information on the training process.
Variations
Model Specification
| Variants |
Num Layers |
Hidden Size |
Num Heads |
Intermediate Size |
Num Parameters (M) |
FLOPs (G) |
MACs (G) |
Max Num Tokens |
| UTRBERT-3mer |
12 |
768 |
12 |
3072 |
86.14 |
22.36 |
11.17 |
512 |
| UTRBERT-4mer |
86.53 |
| UTRBERT-5mer |
88.45 |
| UTRBERT-6mer |
98.05 |
Links
Usage
The model file depends on the multimolecule library. You can install it using pip:
| Bash |
|---|
| pip install multimolecule
|
Direct Use
Note: Default transformers pipeline does not support K-mer tokenization.
You can use this model directly with a pipeline for masked language modeling:
| Python |
|---|
| >>> import multimolecule # you must import multimolecule to register models
>>> from transformers import pipeline
>>> unmasker = pipeline('fill-mask', model='multimolecule/utrbert-3mer')
>>> unmasker("uagc<mask><mask><mask>ucagacugauguuga")[1]
[{'score': 0.510771632194519,
'token': 49,
'token_str': 'CUU',
'sequence': '<cls> UAG AGC <mask> CUU <mask> UCA CAG AGA GAC ACU CUG UGA GAU AUG UGU GUU UUG UGA <eos>'},
{'score': 0.3299057185649872,
'token': 39,
'token_str': 'CCU',
'sequence': '<cls> UAG AGC <mask> CCU <mask> UCA CAG AGA GAC ACU CUG UGA GAU AUG UGU GUU UUG UGA <eos>'},
{'score': 0.09743840992450714,
'token': 34,
'token_str': 'CAU',
'sequence': '<cls> UAG AGC <mask> CAU <mask> UCA CAG AGA GAC ACU CUG UGA GAU AUG UGU GUU UUG UGA <eos>'},
{'score': 0.010745460167527199,
'token': 64,
'token_str': 'GCU',
'sequence': '<cls> UAG AGC <mask> GCU <mask> UCA CAG AGA GAC ACU CUG UGA GAU AUG UGU GUU UUG UGA <eos>'},
{'score': 0.010299043729901314,
'token': 24,
'token_str': 'AUU',
'sequence': '<cls> UAG AGC <mask> AUU <mask> UCA CAG AGA GAC ACU CUG UGA GAU AUG UGU GUU UUG UGA <eos>'}]
|
Downstream Use
Here is how to use this model to get the features of a given sequence in PyTorch:
| Python |
|---|
| from multimolecule import RnaTokenizer, UtrBertModel
tokenizer = RnaTokenizer.from_pretrained('multimolecule/utrbert-3mer')
model = UtrBertModel.from_pretrained('multimolecule/utrbert-3mer')
text = "UAGCUUAUCAGACUGAUGUUGA"
input = tokenizer(text, return_tensors='pt')
output = model(**input)
|
Sequence Classification / Regression
Note: This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for sequence classification or regression.
Here is how to use this model as backbone to fine-tune for a sequence-level task in PyTorch:
| Python |
|---|
| import torch
from multimolecule import RnaTokenizer, UtrBertForSequencePrediction
tokenizer = RnaTokenizer.from_pretrained('multimolecule/utrbert-3mer')
model = UtrBertForSequencePrediction.from_pretrained('multimolecule/utrbert-3mer')
text = "UAGCUUAUCAGACUGAUGUUGA"
input = tokenizer(text, return_tensors='pt')
label = torch.tensor([1])
output = model(**input, labels=label)
|
Nucleotide Classification / Regression
Note: This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for nucleotide classification or regression.
Here is how to use this model as backbone to fine-tune for a nucleotide-level task in PyTorch:
| Python |
|---|
| import torch
from multimolecule import RnaTokenizer, UtrBertForNucleotidePrediction
tokenizer = RnaTokenizer.from_pretrained('multimolecule/utrbert-3mer')
model = UtrBertForNucleotidePrediction.from_pretrained('multimolecule/utrbert-3mer')
text = "UAGCUUAUCAGACUGAUGUUGA"
input = tokenizer(text, return_tensors='pt')
label = torch.randint(2, (len(text), ))
output = model(**input, labels=label)
|
Note: This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for contact classification or regression.
Here is how to use this model as backbone to fine-tune for a contact-level task in PyTorch:
| Python |
|---|
| import torch
from multimolecule import RnaTokenizer, UtrBertForContactPrediction
tokenizer = RnaTokenizer.from_pretrained('multimolecule/utrbert')
model = UtrBertForContactPrediction.from_pretrained('multimolecule/utrbert')
text = "UAGCUUAUCAGACUGAUGUUGA"
input = tokenizer(text, return_tensors='pt')
label = torch.randint(2, (len(text), len(text)))
output = model(**input, labels=label)
|
Training Details
3UTRBERT used Masked Language Modeling (MLM) as the pre-training objective: taking a sequence, the model randomly masks 15% of the tokens in the input then runs the entire masked sentence through the model and has to predict the masked tokens. This is comparable to the Cloze task in language modeling.
Training Data
The 3UTRBERT model was pre-trained on human mRNA transcript sequences from GENCODE.
GENCODE aims to identify all gene features in the human genome using a combination of computational analysis, manual annotation, and experimental validation. The GENCODE release 40 used by this work contains 61,544 genes, and 246,624 transcripts.
3UTRBERT collected the human mRNA transcript sequences from GENCODE, including 108,573 unique mRNA transcripts. Only the longest transcript of each gene was used in the pre-training process. 3UTRBERT only used the 3’ untranslated regions (3’UTRs) of the mRNA transcripts for pre-training to avoid codon constrains in the CDS region, and to reduce increased complexity of the entire mRNA transcripts. The average length of the 3’UTRs was 1,227 nucleotides, while the median length was 631 nucleotides. Each 3’UTR sequence was cut to non-overlapping patches of 510 nucleotides. The remaining sequences were padded to the same length.
Note RnaTokenizer will convert “T”s to “U”s for you, you may disable this behaviour by passing replace_T_with_U=False.
Training Procedure
Preprocessing
3UTRBERT used masked language modeling (MLM) as the pre-training objective. The masking procedure is similar to the one used in BERT:
- 15% of the tokens are masked.
- In 80% of the cases, the masked tokens are replaced by
<mask>.
- In 10% of the cases, the masked tokens are replaced by a random token (different) from the one they replace.
- In the 10% remaining cases, the masked tokens are left as is.
Since 3UTRBERT used k-mer tokenizer, it masks the entire k-mer instead of individual nucleotides to avoid information leakage.
For example, if the k-mer is 3, the sequence "UAGCGUAU" will be tokenized as ["UAG", "AGC", "GCG", "CGU", "GUA", "UAU"]. If the nucleotide "C" is masked, the adjacent tokens will also be masked, resulting ["UAG", "<mask>", "<mask>", "<mask>", "GUA", "UAU"].
PreTraining
The model was trained on 4 NVIDIA Quadro RTX 6000 GPUs with 24GiB memories.
- Batch size: 128
- Learning rate: 3e-4
- Weight decay: 0.01
- Optimizer: AdamW(β1=0.9, β2=0.98, e=1e-6)
- Steps: 200,000
- Learning rate scheduler: Linear
- Learning rate warm-up: 10,000 steps
Citation
BibTeX:
| BibTeX |
|---|
| @article {yang2023deciphering,
author = {Yang, Yuning and Li, Gen and Pang, Kuan and Cao, Wuxinhao and Li, Xiangtao and Zhang, Zhaolei},
title = {Deciphering 3{\textquoteright} UTR mediated gene regulation using interpretable deep representation learning},
elocation-id = {2023.09.08.556883},
year = {2023},
doi = {10.1101/2023.09.08.556883},
publisher = {Cold Spring Harbor Laboratory},
abstract = {The 3{\textquoteright}untranslated regions (3{\textquoteright}UTRs) of messenger RNAs contain many important cis-regulatory elements that are under functional and evolutionary constraints. We hypothesize that these constraints are similar to grammars and syntaxes in human languages and can be modeled by advanced natural language models such as Transformers, which has been very effective in modeling protein sequence and structures. Here we describe 3UTRBERT, which implements an attention-based language model, i.e., Bidirectional Encoder Representations from Transformers (BERT). 3UTRBERT was pre-trained on aggregated 3{\textquoteright}UTR sequences of human mRNAs in a task-agnostic manner; the pre-trained model was then fine-tuned for specific downstream tasks such as predicting RBP binding sites, m6A RNA modification sites, and predicting RNA sub-cellular localizations. Benchmark results showed that 3UTRBERT generally outperformed other contemporary methods in each of these tasks. We also showed that the self-attention mechanism within 3UTRBERT allows direct visualization of the semantic relationship between sequence elements.Competing Interest StatementThe authors have declared no competing interest.},
URL = {https://www.biorxiv.org/content/early/2023/09/12/2023.09.08.556883},
eprint = {https://www.biorxiv.org/content/early/2023/09/12/2023.09.08.556883.full.pdf},
journal = {bioRxiv}
}
|
Please use GitHub issues of MultiMolecule for any questions or comments on the model card.
Please contact the authors of the 3UTRBERT paper for questions or comments on the paper/model.
License
This model is licensed under the AGPL-3.0 License.
| Text Only |
|---|
| SPDX-License-Identifier: AGPL-3.0-or-later
|
multimolecule.models.utrbert
RnaTokenizer
Bases: Tokenizer
Tokenizer for RNA sequences.
Parameters:
| Name |
Type |
Description |
Default |
alphabet |
Alphabet | str | List[str] | None
|
alphabet to use for tokenization.
- If is
None, the standard RNA alphabet will be used.
- If is a
string, it should correspond to the name of a predefined alphabet. The options include
standard
iupac
streamline
nucleobase
- If is an alphabet or a list of characters, that specific alphabet will be used.
|
None
|
nmers |
int
|
Size of kmer to tokenize.
|
1
|
codon |
bool
|
Whether to tokenize into codons.
|
False
|
replace_T_with_U |
bool
|
Whether to replace T with U.
|
True
|
do_upper_case |
bool
|
Whether to convert input to uppercase.
|
True
|
Examples:
Python Console Session>>> from multimolecule import RnaTokenizer
>>> tokenizer = RnaTokenizer()
>>> tokenizer('<pad><cls><eos><unk><mask><null>ACGUNIXVHDBMRWSYK.*-')["input_ids"]
[1, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 2]
>>> tokenizer('acgu')["input_ids"]
[1, 6, 7, 8, 9, 2]
>>> tokenizer('acgt')["input_ids"]
[1, 6, 7, 8, 9, 2]
>>> tokenizer = RnaTokenizer(replace_T_with_U=False)
>>> tokenizer('acgt')["input_ids"]
[1, 6, 7, 8, 3, 2]
>>> tokenizer = RnaTokenizer(nmers=3)
>>> tokenizer('uagcuuauc')["input_ids"]
[1, 83, 17, 64, 49, 96, 84, 22, 2]
>>> tokenizer = RnaTokenizer(codon=True)
>>> tokenizer('uagcuuauc')["input_ids"]
[1, 83, 49, 22, 2]
>>> tokenizer('uagcuuauca')["input_ids"]
Traceback (most recent call last):
ValueError: length of input sequence must be a multiple of 3 for codon tokenization, but got 10
Source code in multimolecule/tokenisers/rna/tokenization_rna.py
| Python |
|---|
| class RnaTokenizer(Tokenizer):
"""
Tokenizer for RNA sequences.
Args:
alphabet: alphabet to use for tokenization.
- If is `None`, the standard RNA alphabet will be used.
- If is a `string`, it should correspond to the name of a predefined alphabet. The options include
+ `standard`
+ `iupac`
+ `streamline`
+ `nucleobase`
- If is an alphabet or a list of characters, that specific alphabet will be used.
nmers: Size of kmer to tokenize.
codon: Whether to tokenize into codons.
replace_T_with_U: Whether to replace T with U.
do_upper_case: Whether to convert input to uppercase.
Examples:
>>> from multimolecule import RnaTokenizer
>>> tokenizer = RnaTokenizer()
>>> tokenizer('<pad><cls><eos><unk><mask><null>ACGUNIXVHDBMRWSYK.*-')["input_ids"]
[1, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 2]
>>> tokenizer('acgu')["input_ids"]
[1, 6, 7, 8, 9, 2]
>>> tokenizer('acgt')["input_ids"]
[1, 6, 7, 8, 9, 2]
>>> tokenizer = RnaTokenizer(replace_T_with_U=False)
>>> tokenizer('acgt')["input_ids"]
[1, 6, 7, 8, 3, 2]
>>> tokenizer = RnaTokenizer(nmers=3)
>>> tokenizer('uagcuuauc')["input_ids"]
[1, 83, 17, 64, 49, 96, 84, 22, 2]
>>> tokenizer = RnaTokenizer(codon=True)
>>> tokenizer('uagcuuauc')["input_ids"]
[1, 83, 49, 22, 2]
>>> tokenizer('uagcuuauca')["input_ids"]
Traceback (most recent call last):
ValueError: length of input sequence must be a multiple of 3 for codon tokenization, but got 10
"""
model_input_names = ["input_ids", "attention_mask"]
def __init__(
self,
alphabet: Alphabet | str | List[str] | None = None,
nmers: int = 1,
codon: bool = False,
replace_T_with_U: bool = True,
additional_special_tokens: List | Tuple | None = None,
do_upper_case: bool = True,
**kwargs,
):
if codon and nmers > 1:
raise ValueError("Codon and nmers cannot be used together.")
if codon:
nmers = 3 # set to 3 to get correct vocab
if not isinstance(alphabet, Alphabet):
alphabet = get_alphabet(alphabet, nmers=nmers)
super().__init__(
alphabet=alphabet,
additional_special_tokens=additional_special_tokens,
do_upper_case=do_upper_case,
**kwargs,
)
self.replace_T_with_U = replace_T_with_U
self.nmers = nmers
self.condon = codon
def _tokenize(self, text: str, **kwargs):
if self.do_upper_case:
text = text.upper()
if self.replace_T_with_U:
text = text.replace("T", "U")
if self.condon:
if len(text) % 3 != 0:
raise ValueError(
f"length of input sequence must be a multiple of 3 for codon tokenization, but got {len(text)}"
)
return [text[i : i + 3] for i in range(0, len(text), 3)]
if self.nmers > 1:
return [text[i : i + self.nmers] for i in range(len(text) - self.nmers + 1)] # noqa: E203
return list(text)
|
UtrBertConfig
Bases: PreTrainedConfig
This is the configuration class to store the configuration of a UtrBertModel.
It is used to instantiate a 3UTRBERT model according to the specified arguments, defining the model architecture.
Instantiating a configuration with the defaults will yield a similar configuration to that of the 3UTRBERT
yangyn533/3UTRBERT architecture.
Configuration objects inherit from PreTrainedConfig and can be used to
control the model outputs. Read the documentation from PreTrainedConfig
for more information.
Parameters:
| Name |
Type |
Description |
Default |
vocab_size |
int | None
|
Vocabulary size of the UTRBERT model. Defines the number of different tokens that can be represented by the
inputs_ids passed when calling [BertModel].
|
None
|
nmers |
int | None
|
kmer size of the UTRBERT model. Defines the vocabulary size of the model.
|
None
|
hidden_size |
int
|
Dimensionality of the encoder layers and the pooler layer.
|
768
|
num_hidden_layers |
int
|
Number of hidden layers in the Transformer encoder.
|
12
|
num_attention_heads |
int
|
Number of attention heads for each attention layer in the Transformer encoder.
|
12
|
intermediate_size |
int
|
Dimensionality of the “intermediate” (often named feed-forward) layer in the Transformer encoder.
|
3072
|
hidden_act |
str
|
The non-linear activation function (function or string) in the encoder and pooler. If string, "gelu",
"relu", "silu" and "gelu_new" are supported.
|
'gelu'
|
hidden_dropout |
float
|
The dropout probability for all fully connected layers in the embeddings, encoder, and pooler.
|
0.1
|
attention_dropout |
float
|
The dropout ratio for the attention probabilities.
|
0.1
|
max_position_embeddings |
int
|
The maximum sequence length that this model might ever be used with. Typically set this to something large
just in case (e.g., 512 or 1024 or 2048).
|
512
|
initializer_range |
float
|
The standard deviation of the truncated_normal_initializer for initializing all weight matrices.
|
0.02
|
layer_norm_eps |
float
|
The epsilon used by the layer normalization layers.
|
1e-12
|
position_embedding_type |
str
|
|
'absolute'
|
is_decoder |
bool
|
Whether the model is used as a decoder or not. If False, the model is used as an encoder.
|
False
|
use_cache |
bool
|
Whether or not the model should return the last key/values attentions (not used by all models). Only
relevant if config.is_decoder=True.
|
True
|
Examples:
Python Console Session>>> from multimolecule import UtrBertConfig, UtrBertModel
Python Console Session>>> # Initializing a UtrBERT multimolecule/utrbert style configuration
>>> configuration = UtrBertConfig(vocab_size=26, nmers=1)
Python Console Session>>> # Initializing a model (with random weights) from the multimolecule/utrbert style configuration
>>> model = UtrBertModel(configuration)
Python Console Session>>> # Accessing the model configuration
>>> configuration = model.config
Source code in multimolecule/models/utrbert/configuration_utrbert.py
| Python |
|---|
| class UtrBertConfig(PreTrainedConfig):
r"""
This is the configuration class to store the configuration of a [`UtrBertModel`][multimolecule.models.UtrBertModel].
It is used to instantiate a 3UTRBERT model according to the specified arguments, defining the model architecture.
Instantiating a configuration with the defaults will yield a similar configuration to that of the 3UTRBERT
[yangyn533/3UTRBERT](https://github.com/yangyn533/3UTRBERT) architecture.
Configuration objects inherit from [`PreTrainedConfig`][multimolecule.models.PreTrainedConfig] and can be used to
control the model outputs. Read the documentation from [`PreTrainedConfig`][multimolecule.models.PreTrainedConfig]
for more information.
Args:
vocab_size:
Vocabulary size of the UTRBERT model. Defines the number of different tokens that can be represented by the
`inputs_ids` passed when calling [`BertModel`].
nmers:
kmer size of the UTRBERT model. Defines the vocabulary size of the model.
hidden_size:
Dimensionality of the encoder layers and the pooler layer.
num_hidden_layers:
Number of hidden layers in the Transformer encoder.
num_attention_heads:
Number of attention heads for each attention layer in the Transformer encoder.
intermediate_size:
Dimensionality of the "intermediate" (often named feed-forward) layer in the Transformer encoder.
hidden_act:
The non-linear activation function (function or string) in the encoder and pooler. If string, `"gelu"`,
`"relu"`, `"silu"` and `"gelu_new"` are supported.
hidden_dropout:
The dropout probability for all fully connected layers in the embeddings, encoder, and pooler.
attention_dropout:
The dropout ratio for the attention probabilities.
max_position_embeddings:
The maximum sequence length that this model might ever be used with. Typically set this to something large
just in case (e.g., 512 or 1024 or 2048).
initializer_range:
The standard deviation of the truncated_normal_initializer for initializing all weight matrices.
layer_norm_eps:
The epsilon used by the layer normalization layers.
position_embedding_type:
Type of position embedding. Choose one of `"absolute"`, `"relative_key"`, `"relative_key_query"`. For
positional embeddings use `"absolute"`. For more information on `"relative_key"`, please refer to
[Self-Attention with Relative Position Representations (Shaw et al.)](https://arxiv.org/abs/1803.02155).
For more information on `"relative_key_query"`, please refer to *Method 4* in [Improve Transformer Models
with Better Relative Position Embeddings (Huang et al.)](https://arxiv.org/abs/2009.13658).
is_decoder:
Whether the model is used as a decoder or not. If `False`, the model is used as an encoder.
use_cache:
Whether or not the model should return the last key/values attentions (not used by all models). Only
relevant if `config.is_decoder=True`.
Examples:
>>> from multimolecule import UtrBertConfig, UtrBertModel
>>> # Initializing a UtrBERT multimolecule/utrbert style configuration
>>> configuration = UtrBertConfig(vocab_size=26, nmers=1)
>>> # Initializing a model (with random weights) from the multimolecule/utrbert style configuration
>>> model = UtrBertModel(configuration)
>>> # Accessing the model configuration
>>> configuration = model.config
"""
model_type = "utrbert"
def __init__(
self,
vocab_size: int | None = None,
nmers: int | None = None,
hidden_size: int = 768,
num_hidden_layers: int = 12,
num_attention_heads: int = 12,
intermediate_size: int = 3072,
hidden_act: str = "gelu",
hidden_dropout: float = 0.1,
attention_dropout: float = 0.1,
max_position_embeddings: int = 512,
initializer_range: float = 0.02,
layer_norm_eps: float = 1e-12,
position_embedding_type: str = "absolute",
is_decoder: bool = False,
use_cache: bool = True,
head: HeadConfig | None = None,
lm_head: MaskedLMHeadConfig | None = None,
**kwargs,
):
super().__init__(**kwargs)
self.vocab_size = vocab_size
self.type_vocab_size = 2
self.nmers = nmers
self.hidden_size = hidden_size
self.num_hidden_layers = num_hidden_layers
self.num_attention_heads = num_attention_heads
self.hidden_act = hidden_act
self.intermediate_size = intermediate_size
self.hidden_dropout = hidden_dropout
self.attention_dropout = attention_dropout
self.max_position_embeddings = max_position_embeddings
self.initializer_range = initializer_range
self.layer_norm_eps = layer_norm_eps
self.position_embedding_type = position_embedding_type
self.is_decoder = is_decoder
self.use_cache = use_cache
self.head = HeadConfig(**head if head is not None else {})
self.lm_head = MaskedLMHeadConfig(**lm_head if lm_head is not None else {})
|
Bases: UtrBertPreTrainedModel
Examples:
Python Console Session>>> from multimolecule import UtrBertConfig, UtrBertForContactPrediction, RnaTokenizer
>>> tokenizer = RnaTokenizer(nmers=1)
>>> config = UtrBertConfig(vocab_size=tokenizer.vocab_size)
>>> model = UtrBertForContactPrediction(config)
>>> input = tokenizer("ACGUN", return_tensors="pt")
>>> output = model(**input, labels=torch.randint(2, (1, 5, 5)))
>>> output["logits"].shape
torch.Size([1, 5, 5, 2])
>>> output["loss"]
tensor(..., grad_fn=<NllLossBackward0>)
Source code in multimolecule/models/utrbert/modeling_utrbert.py
| Python |
|---|
| class UtrBertForContactPrediction(UtrBertPreTrainedModel):
"""
Examples:
>>> from multimolecule import UtrBertConfig, UtrBertForContactPrediction, RnaTokenizer
>>> tokenizer = RnaTokenizer(nmers=1)
>>> config = UtrBertConfig(vocab_size=tokenizer.vocab_size)
>>> model = UtrBertForContactPrediction(config)
>>> input = tokenizer("ACGUN", return_tensors="pt")
>>> output = model(**input, labels=torch.randint(2, (1, 5, 5)))
>>> output["logits"].shape
torch.Size([1, 5, 5, 2])
>>> output["loss"] # doctest:+ELLIPSIS
tensor(..., grad_fn=<NllLossBackward0>)
"""
def __init__(self, config: UtrBertConfig):
super().__init__(config)
self.utrbert = UtrBertModel(config, add_pooling_layer=True)
self.contact_head = ContactPredictionHead(config)
self.head_config = self.contact_head.config
# Initialize weights and apply final processing
self.post_init()
def forward(
self,
input_ids: Tensor | NestedTensor,
attention_mask: Tensor | None = None,
position_ids: Tensor | None = None,
head_mask: Tensor | None = None,
inputs_embeds: Tensor | NestedTensor | None = None,
labels: Tensor | None = None,
output_attentions: bool | None = None,
output_hidden_states: bool | None = None,
return_dict: bool | None = None,
**kwargs,
) -> Tuple[Tensor, ...] | ContactPredictorOutput:
if output_attentions is False:
warn("output_attentions must be True for contact classification and will be ignored.")
return_dict = return_dict if return_dict is not None else self.config.use_return_dict
outputs = self.utrbert(
input_ids,
attention_mask=attention_mask,
position_ids=position_ids,
head_mask=head_mask,
inputs_embeds=inputs_embeds,
output_attentions=True,
output_hidden_states=output_hidden_states,
return_dict=return_dict,
**kwargs,
)
output = self.contact_head(outputs, attention_mask, input_ids, labels)
logits, loss = output.logits, output.loss
if not return_dict:
output = (logits,) + outputs[2:]
return ((loss,) + output) if loss is not None else output
return ContactPredictorOutput(
loss=loss,
logits=logits,
hidden_states=outputs.hidden_states,
attentions=outputs.attentions,
)
|
Bases: UtrBertPreTrainedModel
Examples:
Python Console Session>>> from multimolecule import UtrBertConfig, UtrBertForMaskedLM, RnaTokenizer
>>> tokenizer = RnaTokenizer(nmers=2)
>>> config = UtrBertConfig(vocab_size=tokenizer.vocab_size)
>>> model = UtrBertForMaskedLM(config)
>>> input = tokenizer("ACGUN", return_tensors="pt")
>>> output = model(**input, labels=input["input_ids"])
>>> output["logits"].shape
torch.Size([1, 6, 31])
>>> output["loss"]
tensor(..., grad_fn=<NllLossBackward0>)
Source code in multimolecule/models/utrbert/modeling_utrbert.py
| Python |
|---|
| class UtrBertForMaskedLM(UtrBertPreTrainedModel):
"""
Examples:
>>> from multimolecule import UtrBertConfig, UtrBertForMaskedLM, RnaTokenizer
>>> tokenizer = RnaTokenizer(nmers=2)
>>> config = UtrBertConfig(vocab_size=tokenizer.vocab_size)
>>> model = UtrBertForMaskedLM(config)
>>> input = tokenizer("ACGUN", return_tensors="pt")
>>> output = model(**input, labels=input["input_ids"])
>>> output["logits"].shape
torch.Size([1, 6, 31])
>>> output["loss"] # doctest:+ELLIPSIS
tensor(..., grad_fn=<NllLossBackward0>)
"""
_tied_weights_keys = ["lm_head.decoder.weight", "lm_head.decoder.bias"]
def __init__(self, config: UtrBertConfig):
super().__init__(config)
if config.is_decoder:
logger.warning(
"If you want to use `BertForMaskedLM` make sure `config.is_decoder=False` for "
"bi-directional self-attention."
)
self.utrbert = UtrBertModel(config, add_pooling_layer=False)
self.lm_head = MaskedLMHead(config)
# Initialize weights and apply final processing
self.post_init()
def get_output_embeddings(self):
return self.lm_head.decoder
def set_output_embeddings(self, new_embeddings):
self.lm_head.decoder = new_embeddings
def forward(
self,
input_ids: Tensor | NestedTensor,
attention_mask: Tensor | None = None,
position_ids: Tensor | None = None,
head_mask: Tensor | None = None,
inputs_embeds: Tensor | NestedTensor | None = None,
encoder_hidden_states: Tensor | None = None,
encoder_attention_mask: Tensor | None = None,
labels: Tensor | None = None,
output_attentions: bool | None = None,
output_hidden_states: bool | None = None,
return_dict: bool | None = None,
**kwargs,
) -> Tuple[Tensor, ...] | MaskedLMOutput:
return_dict = return_dict if return_dict is not None else self.config.use_return_dict
outputs = self.utrbert(
input_ids,
attention_mask=attention_mask,
position_ids=position_ids,
head_mask=head_mask,
inputs_embeds=inputs_embeds,
encoder_hidden_states=encoder_hidden_states,
encoder_attention_mask=encoder_attention_mask,
output_attentions=output_attentions,
output_hidden_states=output_hidden_states,
return_dict=return_dict,
**kwargs,
)
output = self.lm_head(outputs, labels)
logits, loss = output.logits, output.loss
if not return_dict:
output = (logits,) + outputs[2:]
return ((loss,) + output) if loss is not None else output
return MaskedLMOutput(
loss=loss,
logits=logits,
hidden_states=outputs.hidden_states,
attentions=outputs.attentions,
)
|
UtrBertForNucleotidePrediction
Bases: UtrBertPreTrainedModel
Examples:
Python Console Session>>> from multimolecule import UtrBertConfig, UtrBertForNucleotidePrediction, RnaTokenizer
>>> tokenizer = RnaTokenizer(nmers=2)
>>> config = UtrBertConfig(vocab_size=tokenizer.vocab_size, nmers=2)
>>> model = UtrBertForNucleotidePrediction(config)
>>> input = tokenizer("ACGUN", return_tensors="pt")
>>> output = model(**input, labels=torch.randn(1, 5, 2))
>>> output["logits"].shape
torch.Size([1, 5, 2])
>>> output["loss"]
tensor(..., grad_fn=<BinaryCrossEntropyWithLogitsBackward0>)
Source code in multimolecule/models/utrbert/modeling_utrbert.py
| Python |
|---|
| class UtrBertForNucleotidePrediction(UtrBertPreTrainedModel):
"""
Examples:
>>> from multimolecule import UtrBertConfig, UtrBertForNucleotidePrediction, RnaTokenizer
>>> tokenizer = RnaTokenizer(nmers=2)
>>> config = UtrBertConfig(vocab_size=tokenizer.vocab_size, nmers=2)
>>> model = UtrBertForNucleotidePrediction(config)
>>> input = tokenizer("ACGUN", return_tensors="pt")
>>> output = model(**input, labels=torch.randn(1, 5, 2))
>>> output["logits"].shape
torch.Size([1, 5, 2])
>>> output["loss"] # doctest:+ELLIPSIS
tensor(..., grad_fn=<BinaryCrossEntropyWithLogitsBackward0>)
"""
def __init__(self, config: UtrBertConfig):
super().__init__(config)
self.utrbert = UtrBertModel(config, add_pooling_layer=False)
self.nucleotide_head = NucleotideKMerHead(config)
self.head_config = self.nucleotide_head.config
# Initialize weights and apply final processing
self.post_init()
def forward(
self,
input_ids: Tensor | NestedTensor,
attention_mask: Tensor | None = None,
position_ids: Tensor | None = None,
head_mask: Tensor | None = None,
inputs_embeds: Tensor | NestedTensor | None = None,
labels: Tensor | None = None,
output_attentions: bool | None = None,
output_hidden_states: bool | None = None,
return_dict: bool | None = None,
**kwargs,
) -> Tuple[Tensor, ...] | NucleotidePredictorOutput:
return_dict = return_dict if return_dict is not None else self.config.use_return_dict
outputs = self.utrbert(
input_ids,
attention_mask=attention_mask,
position_ids=position_ids,
head_mask=head_mask,
inputs_embeds=inputs_embeds,
output_attentions=output_attentions,
output_hidden_states=output_hidden_states,
return_dict=return_dict,
**kwargs,
)
output = self.nucleotide_head(outputs, attention_mask, input_ids, labels)
logits, loss = output.logits, output.loss
if not return_dict:
output = (logits,) + outputs[2:]
return ((loss,) + output) if loss is not None else output
return NucleotidePredictorOutput(
loss=loss,
logits=logits,
hidden_states=outputs.hidden_states,
attentions=outputs.attentions,
)
|
UtrBertForSequencePrediction
Bases: UtrBertPreTrainedModel
Examples:
Python Console Session>>> from multimolecule import UtrBertConfig, UtrBertForSequencePrediction, RnaTokenizer
>>> tokenizer = RnaTokenizer(nmers=4)
>>> config = UtrBertConfig(vocab_size=tokenizer.vocab_size)
>>> model = UtrBertForSequencePrediction(config)
>>> input = tokenizer("ACGUN", return_tensors="pt")
>>> output = model(**input, labels=torch.tensor([[1]]))
>>> output["logits"].shape
torch.Size([1, 2])
>>> output["loss"]
tensor(..., grad_fn=<NllLossBackward0>)
Source code in multimolecule/models/utrbert/modeling_utrbert.py
| Python |
|---|
| class UtrBertForSequencePrediction(UtrBertPreTrainedModel):
"""
Examples:
>>> from multimolecule import UtrBertConfig, UtrBertForSequencePrediction, RnaTokenizer
>>> tokenizer = RnaTokenizer(nmers=4)
>>> config = UtrBertConfig(vocab_size=tokenizer.vocab_size)
>>> model = UtrBertForSequencePrediction(config)
>>> input = tokenizer("ACGUN", return_tensors="pt")
>>> output = model(**input, labels=torch.tensor([[1]]))
>>> output["logits"].shape
torch.Size([1, 2])
>>> output["loss"] # doctest:+ELLIPSIS
tensor(..., grad_fn=<NllLossBackward0>)
"""
def __init__(self, config: UtrBertConfig):
super().__init__(config)
self.utrbert = UtrBertModel(config)
self.sequence_head = SequencePredictionHead(config)
self.head_config = self.sequence_head.config
# Initialize weights and apply final processing
self.post_init()
def forward(
self,
input_ids: Tensor | NestedTensor,
attention_mask: Tensor | None = None,
position_ids: Tensor | None = None,
head_mask: Tensor | None = None,
inputs_embeds: Tensor | NestedTensor | None = None,
labels: Tensor | None = None,
output_attentions: bool | None = None,
output_hidden_states: bool | None = None,
return_dict: bool | None = None,
**kwargs,
) -> Tuple[Tensor, ...] | SequencePredictorOutput:
return_dict = return_dict if return_dict is not None else self.config.use_return_dict
outputs = self.utrbert(
input_ids,
attention_mask=attention_mask,
position_ids=position_ids,
head_mask=head_mask,
inputs_embeds=inputs_embeds,
output_attentions=output_attentions,
output_hidden_states=output_hidden_states,
return_dict=return_dict,
**kwargs,
)
output = self.sequence_head(outputs, labels)
logits, loss = output.logits, output.loss
if not return_dict:
output = (logits,) + outputs[2:]
return ((loss,) + output) if loss is not None else output
return SequencePredictorOutput(
loss=loss,
logits=logits,
hidden_states=outputs.hidden_states,
attentions=outputs.attentions,
)
|
UtrBertForTokenPrediction
Bases: UtrBertPreTrainedModel
Examples:
Python Console Session>>> from multimolecule import UtrBertConfig, UtrBertForTokenPrediction, RnaTokenizer
>>> tokenizer = RnaTokenizer(nmers=2)
>>> config = UtrBertConfig(vocab_size=tokenizer.vocab_size, nmers=2)
>>> model = UtrBertForTokenPrediction(config)
>>> input = tokenizer("ACGUN", return_tensors="pt")
>>> output = model(**input, labels=torch.randint(2, (1, 7)))
>>> output["logits"].shape
torch.Size([1, 7, 2])
>>> output["loss"]
tensor(..., grad_fn=<NllLossBackward0>)
Source code in multimolecule/models/utrbert/modeling_utrbert.py
| Python |
|---|
| class UtrBertForTokenPrediction(UtrBertPreTrainedModel):
"""
Examples:
>>> from multimolecule import UtrBertConfig, UtrBertForTokenPrediction, RnaTokenizer
>>> tokenizer = RnaTokenizer(nmers=2)
>>> config = UtrBertConfig(vocab_size=tokenizer.vocab_size, nmers=2)
>>> model = UtrBertForTokenPrediction(config)
>>> input = tokenizer("ACGUN", return_tensors="pt")
>>> output = model(**input, labels=torch.randint(2, (1, 7)))
>>> output["logits"].shape
torch.Size([1, 7, 2])
>>> output["loss"] # doctest:+ELLIPSIS
tensor(..., grad_fn=<NllLossBackward0>)
"""
def __init__(self, config: UtrBertConfig):
super().__init__(config)
self.num_labels = config.num_labels
self.utrbert = UtrBertModel(config, add_pooling_layer=False)
self.token_head = TokenKMerHead(config)
self.head_config = self.token_head.config
# Initialize weights and apply final processing
self.post_init()
def forward(
self,
input_ids: Tensor | NestedTensor,
attention_mask: Tensor | None = None,
position_ids: Tensor | None = None,
head_mask: Tensor | None = None,
inputs_embeds: Tensor | NestedTensor | None = None,
labels: Tensor | None = None,
output_attentions: bool | None = None,
output_hidden_states: bool | None = None,
return_dict: bool | None = None,
**kwargs,
) -> Tuple[Tensor, ...] | TokenPredictorOutput:
return_dict = return_dict if return_dict is not None else self.config.use_return_dict
outputs = self.utrbert(
input_ids,
attention_mask=attention_mask,
position_ids=position_ids,
head_mask=head_mask,
inputs_embeds=inputs_embeds,
output_attentions=output_attentions,
output_hidden_states=output_hidden_states,
return_dict=return_dict,
**kwargs,
)
output = self.token_head(outputs, attention_mask, input_ids, labels)
logits, loss = output.logits, output.loss
if not return_dict:
output = (logits,) + outputs[2:]
return ((loss,) + output) if loss is not None else output
return TokenPredictorOutput(
loss=loss,
logits=logits,
hidden_states=outputs.hidden_states,
attentions=outputs.attentions,
)
|
UtrBertModel
Bases: UtrBertPreTrainedModel
Examples:
Python Console Session>>> from multimolecule import UtrBertConfig, UtrBertModel, RnaTokenizer
>>> tokenizer = RnaTokenizer(nmers=1)
>>> config = UtrBertConfig(vocab_size=tokenizer.vocab_size)
>>> model = UtrBertModel(config)
>>> input = tokenizer("ACGUN", return_tensors="pt")
>>> output = model(**input)
>>> output["last_hidden_state"].shape
torch.Size([1, 7, 768])
>>> output["pooler_output"].shape
torch.Size([1, 768])
Source code in multimolecule/models/utrbert/modeling_utrbert.py
| Python |
|---|
| class UtrBertModel(UtrBertPreTrainedModel):
"""
Examples:
>>> from multimolecule import UtrBertConfig, UtrBertModel, RnaTokenizer
>>> tokenizer = RnaTokenizer(nmers=1)
>>> config = UtrBertConfig(vocab_size=tokenizer.vocab_size)
>>> model = UtrBertModel(config)
>>> input = tokenizer("ACGUN", return_tensors="pt")
>>> output = model(**input)
>>> output["last_hidden_state"].shape
torch.Size([1, 7, 768])
>>> output["pooler_output"].shape
torch.Size([1, 768])
"""
def __init__(self, config: UtrBertConfig, add_pooling_layer: bool = True):
super().__init__(config)
self.pad_token_id = config.pad_token_id
self.embeddings = UtrBertEmbeddings(config)
self.encoder = UtrBertEncoder(config)
self.pooler = UtrBertPooler(config) if add_pooling_layer else None
# Initialize weights and apply final processing
self.post_init()
def get_input_embeddings(self):
return self.embeddings.word_embeddings
def set_input_embeddings(self, value):
self.embeddings.word_embeddings = value
def _prune_heads(self, heads_to_prune):
"""
Prunes heads of the model. heads_to_prune: dict of {layer_num: list of heads to prune in this layer} See base
class PreTrainedModel
"""
for layer, heads in heads_to_prune.items():
self.encoder.layer[layer].attention.prune_heads(heads)
def forward(
self,
input_ids: Tensor | NestedTensor,
attention_mask: Tensor | None = None,
position_ids: Tensor | None = None,
head_mask: Tensor | None = None,
inputs_embeds: Tensor | NestedTensor | None = None,
encoder_hidden_states: Tensor | None = None,
encoder_attention_mask: Tensor | None = None,
past_key_values: Tuple[Tuple[torch.FloatTensor, torch.FloatTensor], ...] | None = None,
use_cache: bool | None = None,
output_attentions: bool | None = None,
output_hidden_states: bool | None = None,
return_dict: bool | None = None,
**kwargs,
) -> Tuple[Tensor, ...] | BaseModelOutputWithPoolingAndCrossAttentions:
r"""
encoder_hidden_states (`torch.FloatTensor` of shape `(batch_size, sequence_length, hidden_size)`, *optional*):
Sequence of hidden-states at the output of the last layer of the encoder. Used in the cross-attention if
the model is configured as a decoder.
encoder_attention_mask (`torch.FloatTensor` of shape `(batch_size, sequence_length)`, *optional*):
Mask to avoid performing attention on the padding token indices of the encoder input. This mask is used in
the cross-attention if the model is configured as a decoder. Mask values selected in `[0, 1]`:
- 1 for tokens that are **not masked**,
- 0 for tokens that are **masked**.
past_key_values (`tuple(tuple(torch.FloatTensor))` of length `config.n_layers` with each tuple having 4 tensors
of shape `(batch_size, num_heads, sequence_length - 1, embed_size_per_head)`):
Contains precomputed key and value hidden states of the attention blocks. Can be used to speed up decoding.
If `past_key_values` are used, the user can optionally input only the last `decoder_input_ids` (those that
don't have their past key value states given to this model) of shape `(batch_size, 1)` instead of all
`decoder_input_ids` of shape `(batch_size, sequence_length)`.
use_cache (`bool`, *optional*):
If set to `True`, `past_key_values` key value states are returned and can be used to speed up decoding (see
`past_key_values`).
"""
if kwargs:
warn(
f"Additional keyword arguments `{', '.join(kwargs)}` are detected in "
f"`{self.__class__.__name__}.forward`, they will be ignored.\n"
"This is provided for backward compatibility and may lead to unexpected behavior."
)
output_attentions = output_attentions if output_attentions is not None else self.config.output_attentions
output_hidden_states = (
output_hidden_states if output_hidden_states is not None else self.config.output_hidden_states
)
return_dict = return_dict if return_dict is not None else self.config.use_return_dict
if self.config.is_decoder:
use_cache = use_cache if use_cache is not None else self.config.use_cache
else:
use_cache = False
if isinstance(input_ids, NestedTensor):
input_ids, attention_mask = input_ids.tensor, input_ids.mask
if input_ids is not None and inputs_embeds is not None:
raise ValueError("You cannot specify both input_ids and inputs_embeds at the same time")
if input_ids is not None:
self.warn_if_padding_and_no_attention_mask(input_ids, attention_mask)
input_shape = input_ids.size()
elif inputs_embeds is not None:
input_shape = inputs_embeds.size()[:-1]
else:
raise ValueError("You have to specify either input_ids or inputs_embeds")
batch_size, seq_length = input_shape
device = input_ids.device if input_ids is not None else inputs_embeds.device # type: ignore[union-attr]
# past_key_values_length
past_key_values_length = past_key_values[0][0].shape[2] if past_key_values is not None else 0
if attention_mask is None:
attention_mask = (
input_ids.ne(self.pad_token_id)
if self.pad_token_id is not None
else torch.ones(((batch_size, seq_length + past_key_values_length)), device=device)
)
# We can provide a self-attention mask of dimensions [batch_size, from_seq_length, to_seq_length]
# ourselves in which case we just need to make it broadcastable to all heads.
extended_attention_mask: Tensor = self.get_extended_attention_mask(attention_mask, input_shape)
# If a 2D or 3D attention mask is provided for the cross-attention
# we need to make broadcastable to [batch_size, num_heads, seq_length, seq_length]
if self.config.is_decoder and encoder_hidden_states is not None:
encoder_batch_size, encoder_sequence_length, _ = encoder_hidden_states.size()
encoder_hidden_shape = (encoder_batch_size, encoder_sequence_length)
if encoder_attention_mask is None:
encoder_attention_mask = torch.ones(encoder_hidden_shape, device=device)
encoder_extended_attention_mask = self.invert_attention_mask(encoder_attention_mask)
else:
encoder_extended_attention_mask = None
# Prepare head mask if needed
# 1.0 in head_mask indicate we keep the head
# attention_probs has shape bsz x n_heads x N x N
# input head_mask has shape [num_heads] or [num_hidden_layers x num_heads]
# and head_mask is converted to shape [num_hidden_layers x batch x num_heads x seq_length x seq_length]
head_mask = self.get_head_mask(head_mask, self.config.num_hidden_layers)
embedding_output = self.embeddings(
input_ids=input_ids,
position_ids=position_ids,
inputs_embeds=inputs_embeds,
past_key_values_length=past_key_values_length,
)
encoder_outputs = self.encoder(
embedding_output,
attention_mask=extended_attention_mask,
head_mask=head_mask,
encoder_hidden_states=encoder_hidden_states,
encoder_attention_mask=encoder_extended_attention_mask,
past_key_values=past_key_values,
use_cache=use_cache,
output_attentions=output_attentions,
output_hidden_states=output_hidden_states,
return_dict=return_dict,
)
sequence_output = encoder_outputs[0]
pooled_output = self.pooler(sequence_output) if self.pooler is not None else None
if not return_dict:
return (sequence_output, pooled_output) + encoder_outputs[1:]
return BaseModelOutputWithPoolingAndCrossAttentions(
last_hidden_state=sequence_output,
pooler_output=pooled_output,
past_key_values=encoder_outputs.past_key_values,
hidden_states=encoder_outputs.hidden_states,
attentions=encoder_outputs.attentions,
cross_attentions=encoder_outputs.cross_attentions,
)
|
forward
| Python |
|---|
| forward(
input_ids: Tensor | NestedTensor,
attention_mask: Tensor | None = None,
position_ids: Tensor | None = None,
head_mask: Tensor | None = None,
inputs_embeds: Tensor | NestedTensor | None = None,
encoder_hidden_states: Tensor | None = None,
encoder_attention_mask: Tensor | None = None,
past_key_values: (
Tuple[Tuple[FloatTensor, FloatTensor], ...] | None
) = None,
use_cache: bool | None = None,
output_attentions: bool | None = None,
output_hidden_states: bool | None = None,
return_dict: bool | None = None,
**kwargs
) -> (
Tuple[Tensor, ...]
| BaseModelOutputWithPoolingAndCrossAttentions
)
|
encoder_hidden_states (torch.FloatTensor of shape (batch_size, sequence_length, hidden_size), optional):
Sequence of hidden-states at the output of the last layer of the encoder. Used in the cross-attention if
the model is configured as a decoder.
encoder_attention_mask (torch.FloatTensor of shape (batch_size, sequence_length), optional):
Mask to avoid performing attention on the padding token indices of the encoder input. This mask is used in
the cross-attention if the model is configured as a decoder. Mask values selected in [0, 1]:
| Text Only |
|---|
| - 1 for tokens that are **not masked**,
- 0 for tokens that are **masked**.
|
past_key_values (tuple(tuple(torch.FloatTensor)) of length config.n_layers with each tuple having 4 tensors
of shape (batch_size, num_heads, sequence_length - 1, embed_size_per_head)):
Contains precomputed key and value hidden states of the attention blocks. Can be used to speed up decoding.
| Text Only |
|---|
| If `past_key_values` are used, the user can optionally input only the last `decoder_input_ids` (those that
don't have their past key value states given to this model) of shape `(batch_size, 1)` instead of all
`decoder_input_ids` of shape `(batch_size, sequence_length)`.
|
use_cache (bool, optional):
If set to True, past_key_values key value states are returned and can be used to speed up decoding (see
past_key_values).
Source code in multimolecule/models/utrbert/modeling_utrbert.py
| Python |
|---|
| def forward(
self,
input_ids: Tensor | NestedTensor,
attention_mask: Tensor | None = None,
position_ids: Tensor | None = None,
head_mask: Tensor | None = None,
inputs_embeds: Tensor | NestedTensor | None = None,
encoder_hidden_states: Tensor | None = None,
encoder_attention_mask: Tensor | None = None,
past_key_values: Tuple[Tuple[torch.FloatTensor, torch.FloatTensor], ...] | None = None,
use_cache: bool | None = None,
output_attentions: bool | None = None,
output_hidden_states: bool | None = None,
return_dict: bool | None = None,
**kwargs,
) -> Tuple[Tensor, ...] | BaseModelOutputWithPoolingAndCrossAttentions:
r"""
encoder_hidden_states (`torch.FloatTensor` of shape `(batch_size, sequence_length, hidden_size)`, *optional*):
Sequence of hidden-states at the output of the last layer of the encoder. Used in the cross-attention if
the model is configured as a decoder.
encoder_attention_mask (`torch.FloatTensor` of shape `(batch_size, sequence_length)`, *optional*):
Mask to avoid performing attention on the padding token indices of the encoder input. This mask is used in
the cross-attention if the model is configured as a decoder. Mask values selected in `[0, 1]`:
- 1 for tokens that are **not masked**,
- 0 for tokens that are **masked**.
past_key_values (`tuple(tuple(torch.FloatTensor))` of length `config.n_layers` with each tuple having 4 tensors
of shape `(batch_size, num_heads, sequence_length - 1, embed_size_per_head)`):
Contains precomputed key and value hidden states of the attention blocks. Can be used to speed up decoding.
If `past_key_values` are used, the user can optionally input only the last `decoder_input_ids` (those that
don't have their past key value states given to this model) of shape `(batch_size, 1)` instead of all
`decoder_input_ids` of shape `(batch_size, sequence_length)`.
use_cache (`bool`, *optional*):
If set to `True`, `past_key_values` key value states are returned and can be used to speed up decoding (see
`past_key_values`).
"""
if kwargs:
warn(
f"Additional keyword arguments `{', '.join(kwargs)}` are detected in "
f"`{self.__class__.__name__}.forward`, they will be ignored.\n"
"This is provided for backward compatibility and may lead to unexpected behavior."
)
output_attentions = output_attentions if output_attentions is not None else self.config.output_attentions
output_hidden_states = (
output_hidden_states if output_hidden_states is not None else self.config.output_hidden_states
)
return_dict = return_dict if return_dict is not None else self.config.use_return_dict
if self.config.is_decoder:
use_cache = use_cache if use_cache is not None else self.config.use_cache
else:
use_cache = False
if isinstance(input_ids, NestedTensor):
input_ids, attention_mask = input_ids.tensor, input_ids.mask
if input_ids is not None and inputs_embeds is not None:
raise ValueError("You cannot specify both input_ids and inputs_embeds at the same time")
if input_ids is not None:
self.warn_if_padding_and_no_attention_mask(input_ids, attention_mask)
input_shape = input_ids.size()
elif inputs_embeds is not None:
input_shape = inputs_embeds.size()[:-1]
else:
raise ValueError("You have to specify either input_ids or inputs_embeds")
batch_size, seq_length = input_shape
device = input_ids.device if input_ids is not None else inputs_embeds.device # type: ignore[union-attr]
# past_key_values_length
past_key_values_length = past_key_values[0][0].shape[2] if past_key_values is not None else 0
if attention_mask is None:
attention_mask = (
input_ids.ne(self.pad_token_id)
if self.pad_token_id is not None
else torch.ones(((batch_size, seq_length + past_key_values_length)), device=device)
)
# We can provide a self-attention mask of dimensions [batch_size, from_seq_length, to_seq_length]
# ourselves in which case we just need to make it broadcastable to all heads.
extended_attention_mask: Tensor = self.get_extended_attention_mask(attention_mask, input_shape)
# If a 2D or 3D attention mask is provided for the cross-attention
# we need to make broadcastable to [batch_size, num_heads, seq_length, seq_length]
if self.config.is_decoder and encoder_hidden_states is not None:
encoder_batch_size, encoder_sequence_length, _ = encoder_hidden_states.size()
encoder_hidden_shape = (encoder_batch_size, encoder_sequence_length)
if encoder_attention_mask is None:
encoder_attention_mask = torch.ones(encoder_hidden_shape, device=device)
encoder_extended_attention_mask = self.invert_attention_mask(encoder_attention_mask)
else:
encoder_extended_attention_mask = None
# Prepare head mask if needed
# 1.0 in head_mask indicate we keep the head
# attention_probs has shape bsz x n_heads x N x N
# input head_mask has shape [num_heads] or [num_hidden_layers x num_heads]
# and head_mask is converted to shape [num_hidden_layers x batch x num_heads x seq_length x seq_length]
head_mask = self.get_head_mask(head_mask, self.config.num_hidden_layers)
embedding_output = self.embeddings(
input_ids=input_ids,
position_ids=position_ids,
inputs_embeds=inputs_embeds,
past_key_values_length=past_key_values_length,
)
encoder_outputs = self.encoder(
embedding_output,
attention_mask=extended_attention_mask,
head_mask=head_mask,
encoder_hidden_states=encoder_hidden_states,
encoder_attention_mask=encoder_extended_attention_mask,
past_key_values=past_key_values,
use_cache=use_cache,
output_attentions=output_attentions,
output_hidden_states=output_hidden_states,
return_dict=return_dict,
)
sequence_output = encoder_outputs[0]
pooled_output = self.pooler(sequence_output) if self.pooler is not None else None
if not return_dict:
return (sequence_output, pooled_output) + encoder_outputs[1:]
return BaseModelOutputWithPoolingAndCrossAttentions(
last_hidden_state=sequence_output,
pooler_output=pooled_output,
past_key_values=encoder_outputs.past_key_values,
hidden_states=encoder_outputs.hidden_states,
attentions=encoder_outputs.attentions,
cross_attentions=encoder_outputs.cross_attentions,
)
|
UtrBertPreTrainedModel
Bases: PreTrainedModel
An abstract class to handle weights initialization and a simple interface for downloading and loading pretrained
models.
Source code in multimolecule/models/utrbert/modeling_utrbert.py
| Python |
|---|
| class UtrBertPreTrainedModel(PreTrainedModel):
"""
An abstract class to handle weights initialization and a simple interface for downloading and loading pretrained
models.
"""
config_class = UtrBertConfig
base_model_prefix = "utrbert"
supports_gradient_checkpointing = True
_no_split_modules = ["UtrBertLayer", "UtrBertEmbeddings"]
# Copied from transformers.models.bert.modeling_bert.BertPreTrainedModel._init_weights
def _init_weights(self, module: nn.Module):
"""Initialize the weights"""
if isinstance(module, nn.Linear):
# Slightly different from the TF version which uses truncated_normal for initialization
# cf https://github.com/pytorch/pytorch/pull/5617
module.weight.data.normal_(mean=0.0, std=self.config.initializer_range)
if module.bias is not None:
module.bias.data.zero_()
elif isinstance(module, nn.Embedding):
module.weight.data.normal_(mean=0.0, std=self.config.initializer_range)
if module.padding_idx is not None:
module.weight.data[module.padding_idx].zero_()
elif isinstance(module, nn.LayerNorm):
module.bias.data.zero_()
module.weight.data.fill_(1.0)
|