bpRNA-1m¶

bpRNA-1m is a database of single molecule secondary structures annotated using bpRNA.
Disclaimer¶
This is an UNOFFICIAL release of the bpRNA-1m by Center for Quantitative Life Sciences of the Oregon State University.
The team releasing bpRNA did not write this dataset card for this dataset so this dataset card has been written by the MultiMolecule team.
Dataset Description¶
- Homepage: https://multimolecule.danling.org/datasets/bprna
- datasets: https://huggingface.co/datasets/multimolecule/bprna
- Point of Contact: Center for Quantitative Life Sciences of the Oregon State University
- Original URL: https://bprna.cgrb.oregonstate.edu/index.html
Example Entry¶
| id | sequence | secondary_structure | structural_annotation | functional_annotation |
|---|---|---|---|---|
| bpRNA_RFAM_1016 | AUUGCUUCUCGGCCUUUUGGCUAACAUCAAGU… | ......(((.((((....)))).)))...... | EEEEEESSSISSSSHHHHSSSSISSSXXXXXX… | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN… |
Column Description¶
The converted dataset consists of the following columns, each providing specific information about the RNA secondary structures, consistent with the bpRNA standard:
-
id: A unique identifier for each RNA entry. This ID is derived from the original
.stafile name and serves as a reference to the specific RNA structure within the dataset. -
sequence: The nucleotide sequence of the RNA molecule, represented using the standard RNA bases:
- A: Adenine
- C: Cytosine
- G: Guanine
- U: Uracil
-
secondary_structure: The secondary structure of the RNA represented in dot-bracket notation, using up to three types of symbols to indicate base pairing and unpaired regions, as per bpRNA’s standard:
- Dots (
.): Represent unpaired nucleotides. - Parentheses (
(and)): Represent base pairs in standard stems (page 1). - Square Brackets (
[and]): Represent base pairs in pseudoknots (page 2). - Curly Braces (
{and}): Represent base pairs in additional pseudoknots (page 3).
- Dots (
-
structural_annotation: Structural annotations categorizing different regions of the RNA based on their roles within the secondary structure, consistent with bpRNA standards:
- E: External Loop – Regions that are unpaired and external to any loop or helix.
- S: Stem – Paired regions forming helical structures.
- H: Hairpin Loop – Unpaired regions at the end of a stem, forming a loop.
- I: Internal Loop – Unpaired regions between two stems.
- M: Multi-loop – Junctions where three or more stems converge.
- B: Bulge – Unpaired nucleotides on one side of a stem.
- X: Ambiguous or Undetermined – Regions where the structure is unknown or cannot be classified.
- K: Pseudoknot – Regions involved in pseudoknots, where base pairs cross each other.
-
functional_annotation: Functional annotations indicating specific functional elements or regions within the RNA sequence, as defined by bpRNA:
- N: None – No specific functional annotation is assigned.
- K: Pseudoknot – Marks nucleotides involved in pseudoknot structures, which can be functionally significant.
Variations¶
This dataset is available in two variants:
- bpRNA-1m: The main bpRNA-1m dataset.
- bpRNA-1m(90): bpRNA_1m(90) is a subset of bpRNA_1m containing RNAs with less than 90% sequence similarity.
License¶
This dataset is licensed under the AGPL-3.0 License.
| Text Only | |
|---|---|