Metadata-Version: 1.0
Name: graftm
Version: 0.9.3
Summary: GraftM is a pipeline used for identifying and classifying marker gene reads from metagenomic datasets
Home-page: http://geronimp.github.io/graftM
Author: Joel Boyd, Ben Woodcroft
Author-email: UNKNOWN
License: GPL3+
Description: # GraftM
        GraftM is a tool for finding genes of interest in metagenomes, metatranscriptomes, and whole genomes.
        
        Using modular gene packages, GraftM will search the provided sequences using hmmsearch (HMMER) and place the identified sequences into a pre-constructed phylogenetic tree. The provides fast, phylogenetically informed community profiles and genome annotations. GraftM provides tools to:
        * Create and update custom gene packages to use with GraftM
        * Decorate trees, and of course..
        * Analyse sequence datasets using these GraftM packages
        Head over to the [GraftM page](http://geronimp.github.io/graftM/) for more general information.
        
        ### Installation
        GraftM can be installed via pip:
        ```
        pip install graftm
        ```
        However, to use all features of GraftM a few extra binary applications are required:
        * orfm v. >= 0.2.0 (https://github.com/wwood/OrfM)
        * hmmer v. >= 3.1b1 (http://hmmer.janelia.org/)
        * fxtract (https://github.com/ctSkennerton/fxtract)
        * pplacer v. >= 2.6.32 (http://matsen.fhcrc.org/pplacer/)
        * krona v. >= 2.4 (http://sourceforge.net/p/krona/home/krona/)
        * mafft v. >= 7.22 (http://mafft.cbrc.jp/)
        * diamond v. >= 0.7.9 (https://github.com/bbuchfink/diamond)
        
        To create new GraftM packages, you'll also need
        * FastTreeMP (http://www.microbesonline.org/fasttree/)
        
        ### Manual
        A [manual](https://github.com/geronimp/graftM/wiki) is available in the form of the wiki here on GitHub.
        
        ### GraftM packages
        We have a starter pack of graftM packages available including:
        
        * 16S rRNA packages
        * 15 single copy ribosomal protein marker genes
        * The methanogenesis marker mcrA
        
        All are available at the [GraftM package database store](https://drive.google.com/open?id=0BwJ4AwdqUiTzfndmRXowX3MydkM5bG1PYmxRUjNmMUNnazdFaUJaWjJFSkh1UEFDSkpReU0).
        
        Once you have downloaded the package you want, just decompress it as follows:
        
        ```
        tar -xvzf my.tar.gz
        ```
        And you should be good to go!
        
        ### Example
        As an example, we'll use GraftM to classify a single 16S sequence from GreenGenes. Saving the example file as `/tmp/eg.fasta` with the following contents:
        ```
        >229854
        GAGTTTGATCCTGGCTCAGATTGAACGCTGGCGGCATGCTTAACACATGCAAGTCGAACGGCAGCATGACTTAGCTTGCT
        AAGTTGATGGCGAGTGGCGAACGGGTGAGTAACGCGTAGGAATATGCCTTAAAGAGGGGGACAACTTGGGGAAACTCAAG
        CTAATACCGCATAAACTCTTCGGAGAAAAGCTGGGGACTTTCGAGCCTGGCGCTTTAAGATTAGCCTGCGTCCGATTAGC
        ```
        Then we can use GraftM's 61% OTU clustered GraftM package to detect and classify this sequence. Running graftM might look something like this:
        ```
        $ graftM graft --forward /tmp/eg.fasta --graftm_package /path/to/4.01.2013_08_greengenes_61_otus.gpkg/ --output_directory eg.graftm
                                 
                                     GraftM 0.9.2
        
                                        GRAFT
        
                               Joel Boyd, Ben Woodcroft
        
                                                                 __/__
                                                          ______|
                  _- - _                         ________|      |_____/
                   - -            -             |        |____/_
                   - _     >>>>  -   >>>>   ____|
                  - _-  -         -             |      ______
                     - _                        |_____|
                   -                                  |______
                    
        12/02/2015 09:52:06 AM INFO: Working on eg
        12/02/2015 09:52:06 AM INFO: 1 read(s) detected
        12/02/2015 09:52:06 AM INFO: aligning reads to reference package database
        12/02/2015 09:52:06 AM INFO: Filtered 0 short sequences from the alignment
        12/02/2015 09:52:06 AM INFO: 1 sequences remaining
        12/02/2015 09:52:06 AM INFO: Placing reads into phylogenetic tree
        12/02/2015 09:52:07 AM INFO: Placements finished
        12/02/2015 09:52:07 AM INFO: Reading classifications
        12/02/2015 09:52:07 AM INFO: Reads classified
        12/02/2015 09:52:07 AM INFO: Writing summary table
        12/02/2015 09:52:07 AM INFO: Writing biom file
        12/02/2015 09:52:07 AM INFO: Building summary krona plot
        12/02/2015 09:52:07 AM INFO: Cleaning up
        12/02/2015 09:52:07 AM INFO: Done, thanks for using graftM!
        ```
        This creates a folder `eg.graftm` which contains the results.
        
        ### Contact
        If you have any further comments, complaints or recomendations about GraftM, drop an email to the [SupportM](https://groups.google.com/forum/?hl=en#!forum/supportm) public help forum.
        Software by [Joel A. Boyd](http://ecogenomic.org/users/joel-boyd) (@geronimp) and [Ben J. Woodcroft](http://www.ecogenomic.org/users/ben-woodcroft) (@wwood) at the [Australian Centre for Ecogenomics](http://ecogenomic.org)
        Released under GPL3 - see LICENCE.txt for licencing details
        
Platform: UNKNOWN
