Metadata-Version: 2.1
Name: genomepy
Version: 0.9.3
Summary: Automatic downloading and processing of genomes and metadata in command line and Python
Home-page: https://github.com/vanheeringen-lab/genomepy
Author: Simon van Heeringen
Author-email: simon.vanheeringen@gmail.com
License: MIT
Description: # genomepy
        
        [![bioconda-badge](https://img.shields.io/badge/install%20with-bioconda-brightgreen.svg?style=flat)](http://bioconda.github.io)
        [![Anaconda-Server Badge](https://anaconda.org/bioconda/genomepy/badges/downloads.svg)](https://anaconda.org/bioconda/genomepy)
        [![PyPI version](https://badge.fury.io/py/genomepy.svg)](https://badge.fury.io/py/genomepy)
        [![star this repo](https://githubbadges.com/star.svg?user=vanheeringen-lab&repo=genomepy&style=flat)](https://github.com/vanheeringen-lab/genomepy)
        
        [![Build Status](https://travis-ci.org/vanheeringen-lab/genomepy.svg?branch=master)](https://travis-ci.org/vanheeringen-lab/genomepy)
        [![Maintainability](https://api.codeclimate.com/v1/badges/c4476820f1d21a3e0569/maintainability)](https://codeclimate.com/github/vanheeringen-lab/genomepy/maintainability)
        [![Test Coverage](https://api.codeclimate.com/v1/badges/c4476820f1d21a3e0569/test_coverage)](https://codeclimate.com/github/vanheeringen-lab/genomepy/test_coverage)
        
        [![status](http://joss.theoj.org/papers/df434a15edd00c8c2f4076668575d1cd/status.svg)](http://joss.theoj.org/papers/df434a15edd00c8c2f4076668575d1cd)
        [![DOI](https://zenodo.org/badge/DOI/10.5281/zenodo.1010458.svg)](https://doi.org/10.5281/zenodo.1010458)
        
        Easily install and use genomes in Python and elsewhere!
        
        The goal is to have a _simple_ and _straightforward_ way to download and use genomic sequences. 
        Currently, genomepy supports UCSC, Ensembl and NCBI. 
        
        [![asciicast](https://asciinema.org/a/eZttBuf5ly0AnjFVBiEIybbjS.png)](https://asciinema.org/a/eZttBuf5ly0AnjFVBiEIybbjS)
        
        **Pssst, hey there!** Is genomepy not doing what you want? Does it fail? Is it clunky? Is the documentation unclear? Have any other ideas on how to improve it? Don't be shy and [let us know](https://github.com/vanheeringen-lab/genomepy/issues)!
        
        ## Table of Contents
        1.  [Installation](#installation)
        2.  [Quick usage](#quick-usage)
        3.  [Plugins and indexing](#plugins-and-indexing)
        4.  [Configuration](#configuration)
        5.  [Usage](#usage)
            * [Command line](#command-line)
            * [Python](#python)
        6.  [Known issues](#known-issues)
        7.  [Citation](#citation)
        8.  [Getting help](#getting-help)
        9.  [Contributing](#contributing)
        10.  [License](#license)
        
        
        ## Installation
        
        Genomepy works with Python 3.6+. 
        You can install it via [bioconda](https://bioconda.github.io/):
        
        ```
        $ conda config --set use_only_tar_bz2 True
        $ conda install genomepy
        ``` 
        
        Or via pip:
        
        ```
        $ pip install genomepy
        ```
        
        With Pip installation, you will have to install some dependencies.
        Make sure these dependencies are in your PATH.
        
        To read/write bgzipped genomes you will have to install `tabix`.
        
        If you want to use the annotation download feature, 
        you will have to install the following utilities:
        
        * `genePredToBed`
        * `genePredToGtf`
        * `bedToGenePred`
        * `gtfToGenePred`
        * `gff3ToGenePred`
        
        You can find the binaries [here](http://hgdownload.cse.ucsc.edu/admin/exe/).
        
        ## Quick usage
        
        1.  Find your genome: `$ genomepy search zebrafish`
        
          Console output:
          ```
          name      provider    accession          species        tax_id    other_info                 
          GRCz11    Ensembl     GCA_000002035.4    Danio rerio    7955      2017-08-Ensembl/2018-04    
           ^
           Use name for genomepy install
          ```
        
        2.  Install your genome (with annotation): `$ genomepy install --annotation GRCz11 --provider ensembl `
        
          Default genome directory: `~/.local/share/genomes/`
        
        ## Plugins and indexing
        
        By default genomepy generates an index, a file with chromosome sizes and a BED file with
        gap locations (Ns in the sequence). 
        
        For some genomes genomepy can download blacklist files (generated by the Kundaje lab). 
        This will only work when installing these genomes from UCSC. Enable this plugin to use it.
        
        ```
        $ genomepy plugin enable blacklist
        ```
        
        You can also create indices for
        some widely using aligners. Currently, genomepy supports:
        
        * [bowtie2](http://bowtie-bio.sourceforge.net/bowtie2/index.shtml)
        * [bwa](http://bio-bwa.sourceforge.net/) 
        * [gmap](http://research-pub.gene.com/gmap/)
        * [hisat2](https://ccb.jhu.edu/software/hisat2/index.shtml)
        * [minimap2](https://github.com/lh3/minimap2)
        * [star](https://github.com/alexdobin/STAR)
        
        Note 1: these programs are not installed by genomepy and need to be
        installed separately for the indexing to work.
        
        Note 2: splice-aware indexing is performed by Hisat2 and STAR.
        Splice-aware indexing requires the annotation to be downloaded as well. 
        You will receive a warning if indexing is performed without annotation for these aligners.
        
        Note 3: STAR can further improve mapping to (novel) splice junctions by indexing again (2-pass mapping mode). 
        The second pass is currently not supported by genomepy.
        
        You can configure the index creation using the `genomepy plugin` command (see below)
        
        ## Configuration
        
        To change the default configuration, generate a personal config file:
        
        ```
        $ genomepy config generate
        Created config file /home/simon/.config/genomepy/genomepy.yaml
        ```
        
        ### Genome location
        
        By default genomes will be saved in `~/.local/share/genomes`. 
        
        To set the default genome directory, to `/data/genomes` for instance,
        edit `~/.config/genomepy/genomepy.yaml` and change the following line:
        
        ```
        genomes_dir: ~/.local/share/genomes/
        ```
        
        to:
        
        ```
        genomes_dir: /data/genomes
        ```
        
        The genome directory can also be explicitly specified in both the Python API as well as on the command-line.
        
        ### Compression
        
        Optionally genome FASTA files can be saved using bgzip compression. This means that the FASTA 
        files will take up less space on disk. To enable this use the flag `--bgzip` on the command line, or add the following line to your config 
        file:
        
        ```
        bgzip: True
        ```
        
        Most tools are able to use bgzip-compressed genome files. 
        One notable exception is `bedtools getfasta`. As an alternative, you can use the `faidx` command-line
        script from [pyfaidx](https://github.com/mdshw5/pyfaidx) which comes installed with genomepy.
        
        ## Usage
        
        ### Command line
        
        ```
        Usage: genomepy [OPTIONS] COMMAND [ARGS]...
        
        Options:
          --version   Show the version and exit.
          -h, --help  Show this message and exit.
        
        Commands:
          clean      remove provider data
          config     manage configuration
          genomes    list available genomes
          install    install a genome & run active plugins
          plugin     manage plugins
          providers  list available providers
          search     search for genomes
        ```
        
        #### Install a genome.
        
        Find the name of your desired genome:
        
        ```
        $ genomepy search xenopus_tropicalis
        name                       provider    accession          species               tax_id    other_info
        Xenopus_tropicalis_v9.1    Ensembl     GCA_000004195.3    Xenopus tropicalis    8364      2019-04-Ensembl/2019-12
        xenTro1                    UCSC        na                 Xenopus tropicalis    8364      Oct. 2004 (JGI 3.0/xenTro1)
        xenTro2                    UCSC        na                 Xenopus tropicalis    8364      Aug. 2005 (JGI 4.1/xenTro2)
        xenTro3                    UCSC        GCA_000004195.1    Xenopus tropicalis    8364      Nov. 2009 (JGI 4.2/xenTro3)
        xenTro7                    UCSC        GCA_000004195.2    Xenopus tropicalis    8364      Sep. 2012 (JGI 7.0/xenTro7)
        xenTro9                    UCSC        GCA_000004195.3    Xenopus tropicalis    8364      Jul. 2016 (Xenopus_tropicalis_v9.1/xenTro9)
        v4.2                       NCBI        GCA_000004195.1    Xenopus tropicalis    8364      DOE Joint Genome Institute
        Xtropicalis_v7             NCBI        GCA_000004195.2    Xenopus tropicalis    8364      DOE Joint Genome Institute
        Xenopus_tropicalis_v9.1    NCBI        GCA_000004195.3    Xenopus tropicalis    8364      DOE Joint Genome Institute
        UCB_Xtro_10.0              NCBI        GCA_000004195.4    Xenopus tropicalis    8364      University of California, Berkeley
         ^
         Use name for genomepy install
        ```
        
        Note that genomes with a space can be searched for either by using `"quotation marks"`, 
        or by replacing the space(s) with and underscore `_`. 
        For example, we can search for *Xenopus tropicalis* as `"Xenopus Tropicalis"`, 
        `xenopus_tropicalis` or `xenopus`. The search function is case-insensitive. You can also search by taxonomy ID. For instance, to search for [*Xenopus tropicalis*](https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=8364):
        
        ```
        $ genomepy search 8364
        name                       provider    accession          species               tax_id    other_info
        Xenopus_tropicalis_v9.1    Ensembl     GCA_000004195.3    Xenopus tropicalis    8364      2019-04-Ensembl/2019-12
        xenTro1                    UCSC        na                 Xenopus tropicalis    8364      Oct. 2004 (JGI 3.0/xenTro1)
        xenTro2                    UCSC        na                 Xenopus tropicalis    8364      Aug. 2005 (JGI 4.1/xenTro2)
        xenTro3                    UCSC        GCA_000004195.1    Xenopus tropicalis    8364      Nov. 2009 (JGI 4.2/xenTro3)
        xenTro7                    UCSC        GCA_000004195.2    Xenopus tropicalis    8364      Sep. 2012 (JGI 7.0/xenTro7)
        xenTro9                    UCSC        GCA_000004195.3    Xenopus tropicalis    8364      Jul. 2016 (Xenopus_tropicalis_v9.1/xenTro9)
        v4.2                       NCBI        GCA_000004195.1    Xenopus tropicalis    8364      DOE Joint Genome Institute
        Xtropicalis_v7             NCBI        GCA_000004195.2    Xenopus tropicalis    8364      DOE Joint Genome Institute
        Xenopus_tropicalis_v9.1    NCBI        GCA_000004195.3    Xenopus tropicalis    8364      DOE Joint Genome Institute
        UCB_Xtro_10.0              NCBI        GCA_000004195.4    Xenopus tropicalis    8364      University of California, Berkeley
         ^
         Use name for genomepy install
        ```
        
        Lets say we want to download the *Xenopus tropicalis* genome from UCSC.
        Copy the name returned by the search function to install:
        
        ```
        $ genomepy install xenTro9
        ```
        
        Since we did not specify the provider here, genomepy will use the first provider it can find with `xenTro9`. Since we learned in `genomepy search` that only UCSC uses this name, it will be UCSC.
        We can also specify genomepy to use UCSC by giving it the provider name with `-p`:
        
        ```
        $ genomepy install xenTro9 -p UCSC
        Downloading genome from http://hgdownload.soe.ucsc.edu/goldenPath/xenTro9/bigZips/xenTro9.fa.gz...
        Genome download successful, starting post processing...
        
        name: xenTro9
        local name: xenTro9
        fasta: /data/genomes/xenTro9/xenTro9.fa
        ```
        
        Here, genomes are downloaded to the directory specified in the config file. 
        To choose a different directory, use the `-g` option.
        
        ```
        $ genomepy install sacCer3 -p UCSC -g /path/to/my/genomes
        Downloading genome from http://hgdownload.soe.ucsc.edu/goldenPath/sacCer3/bigZips/chromFa.tar.gz...
        Genome download successful, starting post processing...
        
        name: sacCer3
        local name: sacCer3
        fasta: /path/to/my/genomes/sacCer3/sacCer3.fa
        ```
        
        You can use a regular expression to filter for matching sequences 
        (or non-matching sequences by using the `--no-match` option). For instance, 
        the following command downloads hg38 and saves only the major chromosomes:
        
        ```
        $ genomepy install hg38 -p UCSC -r 'chr[0-9XY]+$'
        downloading from http://hgdownload.soe.ucsc.edu/goldenPath/hg38/bigZips/hg38.fa.gz...
        done...
        name: hg38
        local name: hg38
        fasta: /data/genomes/hg38/hg38.fa
        $ grep ">" /data/genomes/hg38/hg38.fa
        >chr1
        >chr10
        >chr11
        >chr12
        >chr13
        >chr14
        >chr15
        >chr16
        >chr17
        >chr18
        >chr19
        >chr2
        >chr20
        >chr21
        >chr22
        >chr3
        >chr4
        >chr5
        >chr6
        >chr7
        >chr8
        >chr9
        >chrX
        >chrY
        ```
        
        By default, sequences are soft-masked. Use `-m hard` for hard masking, or `-m none` for no masking.
        
        The chromosome sizes are saved in file called `<genome_name>.fa.sizes`.
        
        You can choose to download gene annotation files with the `--annotation` option. 
        These will be saved in (gzipped) BED and GTF format. 
        
        ```
        $ genomepy  install hg38 -p UCSC --annotation
        ```
        
        To facilitate the downloading of genomes not supported by either NCBI, UCSC, or Ensembl, genomes 
        can also be downloaded directly from an url:
        ```
        $ genomepy install https://research.nhgri.nih.gov/hydra/download/assembly/\Hm105_Dovetail_Assembly_1.0.fa.gz -p url
        ```
        This installs the genome under the filename of the link, but can be changed with the `--localname` 
        option
        
        Finally, in the spirit of reproducibility all selected options are stored in a `README.txt`. 
        This includes the original name, download location and other genomepy operations (such as regex filtering and time).
        
        #### Manage plugins.
        
        Use `genomepy plugin list` to view the available plugins.
        
        ```
        $ genomepy plugin list
        plugin              enabled
        bowtie2             
        bwa                 
        gmap                
        hisat2              
        minimap2            
        star
        blacklist
        ```
        
        Enable plugins as follows:
        
        ```
        $ genomepy plugin enable bwa hisat2
        Enabled plugins: bwa, hisat2
        ```
        
        And disable like this:
        
        ```
        $ genomepy plugin disable bwa
        Enabled plugins: hisat2
        ```
        
        #### Search for a genome.
        
        ```
        $ genomepy search Xenopus
        NCBI	Xenopus_tropicalis_v9.1	Xenopus tropicalis; DOE Joint Genome Institute
        NCBI	ViralProj30173	Xenopus laevis endogenous retrovirus Xen1; 
        NCBI	Xenopus_laevis_v2	Xenopus laevis; International Xenopus Sequencing Consortium
        NCBI	v4.2	Xenopus tropicalis; DOE Joint Genome Institute
        NCBI	Xtropicalis_v7	Xenopus tropicalis; DOE Joint Genome Institute
        Ensembl	JGI 4.2	Xenopus
        ```
        
        Only search a specific provider:
        
        ```
        $ genomepy search tropicalis -p UCSC
        UCSC	xenTro7	X. tropicalis Sep. 2012 (JGI 7.0/xenTro7) Genome at UCSC
        UCSC	xenTro3	X. tropicalis Nov. 2009 (JGI 4.2/xenTro3) Genome at UCSC
        UCSC	xenTro2	X. tropicalis Aug. 2005 (JGI 4.1/xenTro2) Genome at UCSC
        UCSC	xenTro1	X. tropicalis Oct. 2004 (JGI 3.0/xenTro1) Genome at UCSC
        ```
        
        Note that searching doesn't work flawlessly, so try a few variations if 
        you don't get any results. 
        
        Note that genomes with a space can be searched for either by using `"quotation marks"`,
        or by replacing the space(s) with and underscore `_`. 
        
        Search is case-insensitive.
        
        #### List available providers
        
        ```
        $ genomepy providers
        Ensembl
        UCSC
        NCBI
        URL
        ```
        
        #### List available genomes
        
        You can constrain the genome list by using the `-p` option to search only a 
        specific provider. 
        
        ```
        $ genomepy genomes -p UCSC
        UCSC	hg38	Human Dec. 2013 (GRCh38/hg38) Genome at UCSC
        UCSC	hg19	Human Feb. 2009 (GRCh37/hg19) Genome at UCSC
        UCSC	hg18	Human Mar. 2006 (NCBI36/hg18) Genome at UCSC
        ...
        UCSC	danRer4	Zebrafish Mar. 2006 (Zv6/danRer4) Genome at UCSC
        UCSC	danRer3	Zebrafish May 2005 (Zv5/danRer3) Genome at UCSC
        ```
        
        #### Manage configuration
        
        List the current configuration file that genomepy uses:
        
        ```
        $ genomepy config file
        /home/simon/.config/genomepy/genomepy.yaml
        ```
        
        To show the contents of the config file:
        
        ```
        $ genomepy config show
        # Directory were downloaded genomes will be stored
        genomes_dir: ~/.local/share/genomes/
        
        plugin:
         - blacklist
        ```
        
        To generate a personal configuration file (existing file will be overwritten):
        
        ```
        $ genomepy config generate
        Created config file /home/simon/.config/genomepy/genomepy.yaml
        ```
        
        #### Local cache. 
        
        Note that the first time you run `genomepy search` or `list` the command will take a long time
        as the genome lists have to be downloaded. 
        The lists are cached locally, which will save time later. The cached files are stored in 
        `~/.cache/genomepy` and expire after 7 days. You can also delete this directory to clean the 
        cache using `genomepy clean`.
        
        ### Python
        
        ```
        >>> import genomepy
        >>> for row in genomepy.search("GRCh38"):
        ...    print("\t".join([x.decode('utf-8') for x in row]))
        ...    
        GRCh38.p13	Ensembl	GCA_000001405.28	Homo sapiens	9606	2014-01-Ensembl/2020-03
        hg38	UCSC	GCA_000001405.27	Homo sapiens	9606	Dec. 2013 (GRCh38/hg38)
        GRCh38	NCBI	GCA_000001405.15	Homo sapiens	9606	Genome Reference Consortium
        GRCh38.p1	NCBI	GCA_000001405.16	Homo sapiens	9606	Genome Reference Consortium
        GRCh38.p2	NCBI	GCA_000001405.17	Homo sapiens	9606	Genome Reference Consortium
        GRCh38.p3	NCBI	GCA_000001405.18	Homo sapiens	9606	Genome Reference Consortium
        GRCh38.p4	NCBI	GCA_000001405.19	Homo sapiens	9606	Genome Reference Consortium
        GRCh38.p5	NCBI	GCA_000001405.20	Homo sapiens	9606	Genome Reference Consortium
        GRCh38.p6	NCBI	GCA_000001405.21	Homo sapiens	9606	Genome Reference Consortium
        GRCh38.p7	NCBI	GCA_000001405.22	Homo sapiens	9606	Genome Reference Consortium
        GRCh38.p8	NCBI	GCA_000001405.23	Homo sapiens	9606	Genome Reference Consortium
        GRCh38.p9	NCBI	GCA_000001405.24	Homo sapiens	9606	Genome Reference Consortium
        GRCh38.p10	NCBI	GCA_000001405.25	Homo sapiens	9606	Genome Reference Consortium
        GRCh38.p11	NCBI	GCA_000001405.26	Homo sapiens	9606	Genome Reference Consortium
        GRCh38.p12	NCBI	GCA_000001405.27	Homo sapiens	9606	Genome Reference Consortium
        GRCh38.p13	NCBI	GCA_000001405.28	Homo sapiens	9606	Genome Reference Consortium
        
        >>> genomepy.install_genome("hg38", "UCSC", genomes_dir="./data/genomes")
        Downloading genome from UCSC.
        Target URL: http://hgdownload.soe.ucsc.edu/goldenPath/hg38/bigZips/hg38.fa.gz...
        Genome download successful, starting post processing...
        name: hg38
        local name: hg38
        fasta: ./data/genomes/hg38/hg38.fa
        
        >>> g = genomepy.Genome("hg38", genomes_dir="./data/genomes")
        >>> g["chr6"][166502000:166502100]
        >chr6:166502001-166502100
        tgtatggtccctagaggggccagagtcacagagatggaaagtggatggcgggtgccgggggctggggagctactgtgcagggggacagagctttagttct
        ```
        
        The `genomepy.Genome()` method returns a Genome object. This has all the
        functionality of a `pyfaidx.Fasta` object, 
        see the [documentation](https://github.com/mdshw5/pyfaidx) for more examples on how to use this.
        
        ## Known issues
        
        Genomepy utilizes external databases to obtain your files. Unfortunately this sometimes causes issues.
        Here are some of the more common issues with solutions.
        
        Let us know if you encounter issues you cannot solve!
        
        #### Provider is offline/URL is broken
        Occasionally one of the providers experience connection issues, which can last anywhere between seconds to hours.
        When this happens genomepy will warn that the provider is offline, or that the URL is broken.
        
        Connection issues are usually resolved in minutes.
        
        #### A genome is missing from `genomepy search`
        Genomepy stores provider data on your computer to rerun it faster later.
        If a provider was offline during this time, it may miss (parts of) the data.
        
        To re-download the data, remove the local data with `genomepy clean`, then `search` for your genome again.
        
        #### URL is still broken
        Sadly, not everything (naming, structure, filenames) is always consistent on the provider end. Contact the provider to get it fixed!
        One notable group are Ensembl fungi, which seems to be mostly mislabelled.
        
        In the meantime, you can still use the power of genomepy by manually retrieving the URLs,
        and downloading the files with `genomepy install GENOME_URL -p url --url-to-annotation ANNOTATION_URL`.
        
        ## Citation
        
        If you use genomepy in your research, please cite it: [10.21105/joss.00320](http://dx.doi.org/10.21105/joss.00320).
        
        ## Getting help
        
        If you want to report a bug or issue, or have problems with installing or running the software please create [a new issue](https://github.com/vanheeringen-lab/genomepy/issues). This is the preferred way of getting support. Alternatively, you can [mail me](mailto:simon.vanheeringen@gmail.com).
        
        ## Contributing
        
        Contributions welcome! Send me a pull request or [get in touch](mailto:simon.vanheeringen@gmail.com).
        
        When contributing a PR, please use the [develop](https://github.com/vanheeringen-lab/genomepy/tree/develop) branch.
        
        ### Quick development setup: 
        1. Fork & download this repo. 
        2. `cd` into your local repo. 
        3. `git checkout develop`
        4. `conda env create python=3.6 -f environment.yaml`
        5. `conda activate genomepy`
        6. `python setup.py develop`
        7. `python setup.py build`
        8. `git checkout -b` your_develop_branch
        
        The command line and python imports will now use the code in your local repo. 
        To test your changes locally, run the following command:
        `pytest -vv --disable-pytest-warnings`
        
        ## Contributors
        
        - Siebren Frölich - [@siebrenf](https://github.com/siebrenf)
        - Simon van Heeringen - [@simonvh](https://github.com/simonvh)
        - Maarten van der Sande - [@Maarten-vd-Sande](https://github.com/Maarten-vd-Sande)
        - Dohoon Lee - [@dohlee](https://github.com/dohlee)
        - Jie Zhu - [@alienzj](https://github.com/alienzj)
        
        ## License
        
        This module is licensed under the terms of the [MIT license](https://opensource.org/licenses/MIT).
        
Platform: UNKNOWN
Classifier: Development Status :: 4 - Beta
Classifier: Intended Audience :: Developers
Classifier: Intended Audience :: Science/Research
Classifier: License :: OSI Approved :: MIT License
Classifier: Operating System :: MacOS :: MacOS X
Classifier: Operating System :: POSIX :: Linux
Classifier: Programming Language :: Python
Classifier: Programming Language :: Python :: 3
Classifier: Topic :: Scientific/Engineering :: Bio-Informatics
Description-Content-Type: text/markdown
