#!/usr/bin/perl
use warnings;
use strict;
$|++;
use Getopt::Long;
use Cwd;
use Carp;

my @filenames; # input files
my %counting;
my $parent_dir = getcwd();

my %fhs;

my $version = 'v0.7.7';
my ($ignore,$genomic_fasta,$single,$paired,$full,$report,$no_overlap,$merge_non_CpG,$vanilla,$output_dir,$no_header,$bedGraph,$remove,$coverage_threshold,$counts,$cytosine_report,$genome_folder,$zero,$CpG_only,$CX_context,$split_by_chromosome) = process_commandline();


### only needed for bedGraph output
my @sorting_files; # if files are to be written to bedGraph format, these are the methylation extractor output files
my @methylcalls = qw (0 0 0); # [0] = methylated, [1] = unmethylated, [2] = total
my @bedfiles;

### only needed for genome-wide cytosine methylation report
my %chromosomes;

##############################################################################################
### Summarising Run Parameters
##############################################################################################

### METHYLATION EXTRACTOR

warn "Summarising Bismark methylation extractor parameters:\n";
warn '='x63,"\n";

if ($single){
  if ($vanilla){
    warn "Bismark single-end vanilla format specified\n";
  }
  else{
    warn "Bismark single-end SAM format specified (default)\n"; # default
  }
}
elsif ($paired){
  if ($vanilla){
    warn "Bismark paired-end vanilla format specified\n";
  }
  else{
    warn "Bismark paired-end SAM format specified (default)\n"; # default
  }
}

if ($ignore){
  warn "First $ignore bases will be disregarded when processing the methylation call string\n";
}

if ($full){
  warn "Strand-specific outputs will be skipped. Separate output files for cytosines in CpG, CHG and CHH context will be generated\n";
}
if ($merge_non_CpG){
  warn "Merge CHG and CHH context to non-CpG context specified\n";
}
### output directory
if ($output_dir eq ''){
  warn "Output will be written to the current directory ('$parent_dir')\n";
}
else{
  warn "Output path specified as: $output_dir\n";
}


sleep (1);

### BEDGRAPH

if ($bedGraph){
  warn "\n\nSummarising bedGraph parameters:\n";
  warn '='x63,"\n";

  if ($counts){
    warn "Generating additional output in bedGraph format including methylating counts (output format: <Chromosome> <Start Position> <End Position> <Methylation Percentage> <count methylated> <count non-methylated>)\n";
  }
  else{
    warn "Generating additional sorted output in bedGraph format (output format: <Chromosome> <Start Position> <End Position> <Methylation Percentage>)\n";
  }

  warn "Using a cutoff of $coverage_threshold read(s) to report cytosine positions\n";

  if ($CX_context){
    warn "Reporting and sorting methylation information for all cytosine context (sorting may take a long time, you have been warned ...)\n";
  }
  else{ # default
    $CpG_only = 1;
    warn "Reporting and sorting cytosine methylation information in CpG context only (default)\n";
  }

  if ($remove){
    warn "White spaces in read ID names will be removed prior to sorting\n";
  }

  sleep (1);

  if ($cytosine_report){
    warn "\n\nSummarising genome-wide cytosine methylation report parameters:\n";
    warn '='x63,"\n";
    warn "Generating comprehensive genome-wide cytosine report (output format: <Chromosome> <Start Position> <End Position> <Methylation Percentage> )\n";


    if ($CX_context){
      warn "Reporting methylation for all cytosine contexts. Be aware that this will generate enormous files\n";
    }
    else{ # default
      $CpG_only = 1;
      warn "Reporting cytosine methylation in CpG context only (default)\n";
    }

    if ($split_by_chromosome){
      warn "Splitting the cytosine report output up into individual files for each chromosome\n";
    }

    ### Zero-based coordinates
    if ($zero){
      warn "Using zero-based genomic coordinates (user-defined)\n";
    }
    else{ # default, 1-based coords
      warn "Using 1-based genomic coordinates (default)\n";
    }

    ### GENOME folder
    if ($genome_folder){
      unless ($genome_folder =~/\/$/){
	$genome_folder =~ s/$/\//;
      }
      warn "Genome folder was specified as $genome_folder\n";
    }
    else{
      $genome_folder  = '/data/public/Genomes/Mouse/NCBIM37/';
      warn "Using the default genome folder /data/public/Genomes/Mouse/NCBIM37/\n";
    }
    sleep (1);
  }
}

warn "\n";
sleep (5);

######################################################
### PROCESSING FILES
######################################################

foreach my $filename (@filenames){
  # resetting counters and filehandles
  %fhs = ();
  %counting =(
	      total_meCHG_count => 0,
	      total_meCHH_count => 0,
	      total_meCpG_count => 0,
	      total_unmethylated_CHG_count => 0,
	      total_unmethylated_CHH_count => 0,
	      total_unmethylated_CpG_count => 0,
	      sequences_count => 0,
	     );
  @sorting_files = ();
  @bedfiles = ();

  process_Bismark_results_file($filename);

  if ($bedGraph){
    my $out = $filename;
    $out =~ s/sam$//;
    $out =~ s/txt$//;
    $out =~ s/$/bedGraph/;

    my $bedGraph_output = $out;
    open (OUT,'>',$output_dir.$out) or die $!;
    # warn "Writing bedGraph to file: $out\n";

    process_bedGraph_output();
    close OUT or die $!;

    ### genome-wide cytosine methylation report requires bedGraph processing anyway
    if ($cytosine_report){
      my $cytosine_out = $out;
      $cytosine_out =~ s/bedGraph$//;

      read_genome_into_memory();
      generate_genome_wide_cytosine_report($bedGraph_output,$cytosine_out);
    }
  }
}


sub process_commandline{
  my $help;
  my $single_end;
  my $paired_end;
  my $ignore;
  my $genomic_fasta;
  my $full;
  my $report;
  my $extractor_version;
  my $no_overlap;
  my $merge_non_CpG;
  my $vanilla;
  my $output_dir;
  my $no_header;
  my $bedGraph;
  my $coverage_threshold = 1; # Minimum number of reads covering before calling methylation status
  my $remove;
  my $counts;
  my $cytosine_report;
  my $genome_folder;
  my $zero;
  my $CpG_only;
  my $CX_context;
  my $split_by_chromosome;


  my $command_line = GetOptions ('help|man' => \$help,
				 'p|paired-end' => \$paired_end,
				 's|single-end' => \$single_end,
				 'fasta' => \$genomic_fasta,
				 'ignore=i' => \$ignore,
				 'comprehensive' => \$full,
				 'report' => \$report,
				 'version' => \$extractor_version,
				 'no_overlap' => \$no_overlap,
				 'merge_non_CpG' => \$merge_non_CpG, 
				 'vanilla' => \$vanilla,
				 'o|output=s' => \$output_dir,
				 'no_header' => \$no_header,
				 'bedGraph' => \$bedGraph,
				 "cutoff=i" => \$coverage_threshold,
				 "remove_spaces" => \$remove,
				 "counts" => \$counts,
				 "cytosine_report" => \$cytosine_report,
				 'g|genome_folder=s' => \$genome_folder,
				 "zero_based" => \$zero,	
				 "CX|CX_context" => \$CX_context,
				 "split_by_chromosome" => \$split_by_chromosome,
				);

  ### EXIT ON ERROR if there were errors with any of the supplied options
  unless ($command_line){
    die "Please respecify command line options\n";
  }

  ### HELPFILE
  if ($help){
    print_helpfile();
    exit;
  }

  if ($extractor_version){
    print << "VERSION";


                           Bismark Methylation Extractor

   Bismark Extractor Version: $version Copyright 2010-12 Felix Krueger, Babraham Bioinformatics
                www.bioinformatics.babraham.ac.uk/projects/bismark/


VERSION
    exit;
  }


  ### no files provided
  unless (@ARGV){
    die "You need to provide one or more Bismark files to create an individual C methylation output. Please respecify!\n";
  }
  @filenames = @ARGV;

  warn "\n *** Bismark methylation extractor version $version ***\n\n";

  ### IGNORING <INT> bases at the start of the read when processing the methylation call string
  unless ($ignore){
    $ignore = 0;
  }
  ### PRINT A REPORT
  unless ($report){
    $report = 0;
  }

  ### OUTPUT DIR PATH
  if ($output_dir){
    unless ($output_dir =~ /\/$/){
      $output_dir =~ s/$/\//;
    }
  }
  else{
    $output_dir = '';
  }

  ### NO HEADER
  unless ($no_header){
    $no_header = 0;
  }

  ### OLD (VANILLA) OUTPUT FORMAT
  unless ($vanilla){
    $vanilla = 0;
  }

  if ($single_end){
    $paired_end = 0;   ### SINGLE END ALIGNMENTS
  }
  elsif ($paired_end){
    $single_end = 0;   ### PAIRED-END ALIGNMENTS
  }
  else{
    die "Please specify whether the supplied file(s) are in Bismark single-end or paired-end format\n\n";
  }

  ### NO OVERLAP
  if ($no_overlap){
    die "The option '--no_overlap' can only be specified for paired-end input!\n" unless ($paired_end);
  }
  else{
    $no_overlap = 0;
  }

  ### COMPREHENSIVE OUTPUT
  unless ($full){
    $full = 0;
  }

  ### MERGE NON-CpG context
  unless ($merge_non_CpG){
    $merge_non_CpG = 0;
  }

  ### remove white spaces in read ID (needed for sorting using the sort command
  unless ($remove){
    $remove = 0;
  }

  ### COVERAGE THRESHOLD FOR gedGraph OUTPUT
  unless (defined $coverage_threshold){
    unless ($coverage_threshold > 0){
      die "Please select a coverage greater than 0 (positive integers only)\n";
    }
    $coverage_threshold = 1;
  }

  if ($zero){
    die "Option '--zero' is only available if  '--cytosine_report' is specified as well. Please respecify\n" unless ($cytosine_report);
  }

  if ($CX_context){
    die "Option '--CX_context' is only available if  '--cytosine_report' or '--bedGraph' is specified as well. Please respecify\n" unless ($cytosine_report or $bedGraph);
  }

  if ($cytosine_report){

    ### GENOME folder
    if ($genome_folder){
      unless ($genome_folder =~/\/$/){
	$genome_folder =~ s/$/\//;
      }
    }
    else{
      die "Please specify a genome folder to proceed (full path only)\n";
    }

    unless ($bedGraph){
      warn "Setting the option '--bedGraph' since this is required for the genome-wide cytosine report\n";
      $bedGraph = 1;
    }
    unless ($counts){
      warn "Setting the option '--counts' since this is required for the genome-wide cytosine report\n";
      $counts = 1;
    }
    warn "\n";
  }

  return ($ignore,$genomic_fasta,$single_end,$paired_end,$full,$report,$no_overlap,$merge_non_CpG,$vanilla,$output_dir,$no_header,$bedGraph,$remove,$coverage_threshold,$counts,$cytosine_report,$genome_folder,$zero,$CpG_only,$CX_context,$split_by_chromosome);
}


sub process_Bismark_results_file{
  my $filename = shift;

  warn "\nNow reading in Bismark result file $filename\n\n";

  if ($filename =~ /\.gz$/) {
    open (IN,"zcat $filename |") or die "Can't open gzipped file $filename: $!\n";
  } else {
    open (IN,$filename) or die "Can't open file $filename: $!\n";
  }

  ### Vanilla and SAM output need to read different numbers of header lines
  if ($vanilla) {
    my $bismark_version = <IN>; ## discarding the Bismark version info
    chomp $bismark_version;
    $bismark_version =~ s/\r//; # replaces \r line feed
    $bismark_version =~  s/Bismark version: //;
    if ($bismark_version =~ /^\@/) {
      warn "Detected \@ as the first character of the version information. Is it possible that the file is in SAM format?\n\n";
      sleep (2);
    }

    unless ($version eq $bismark_version){
      die "The methylation extractor and Bismark itself need to be of the same version!\n\nVersions used:\nmethylation extractor: '$version'\nBismark: '$bismark_version'\n";
    }
  } else {
    # If the read is in SAM format (default) it can either start with @ header lines or start with alignments directly.
    # We are reading from it further down
  }

  my $output_filename = (split (/\//,$filename))[-1];

  ### OPENING OUTPUT-FILEHANDLES
  if ($report) {
    my $report_filename = $output_filename;
    $report_filename =~ s/[\.sam|\.txt]$//;
    $report_filename =~ s/$/_splitting_report.txt/;
    $report_filename = $output_dir . $report_filename;
    open (REPORT,'>',$report_filename) or die "Failed to write to file $report_filename $!\n";
  }

  if ($report) {
    print REPORT "$output_filename\n\n";
    print REPORT "Parameters used to extract methylation information:\n";
    if ($paired) {
      if ($vanilla) {
	print REPORT "Bismark result file: paired-end (vanilla Bismark format)\n";
      } else {
	print REPORT "Bismark result file: paired-end (SAM format)\n"; # default
      }
    }

    if ($single) {
      if ($vanilla) {
	print REPORT "Bismark result file: single-end (vanilla Bismark format)\n";
      } else {
	print REPORT "Bismark result file: single-end (SAM format)\n"; # default
      }
    }

    if ($ignore) {
      print REPORT "Ignoring first $ignore bases\n";
    }

    if ($full) {
      print REPORT "Output specified: comprehensive\n";
    } else {
      print REPORT "Output specified: strand-specific (default)\n";
    }

    if ($no_overlap) {
      print REPORT "No overlapping methylation calls specified\n";
    }
    if ($genomic_fasta) {
      print REPORT "Genomic equivalent sequences will be printed out in FastA format\n";
    }
    if ($merge_non_CpG) {
      print REPORT "Methylation in CHG and CHH context will be merged into \"non-CpG context\" output\n";
    }

    print REPORT "\n";
  }

  ### CpG-context and non-CpG context. THIS SECTION IS OPTIONAL
  ### if --comprehensive AND --merge_non_CpG was specified we are only writing out one CpG-context and one Any-Other-context result file
  if ($full and $merge_non_CpG) {
    my $cpg_output = my $other_c_output = $output_filename;
    ### C in CpG context
    $cpg_output =~ s/^/CpG_context_/;
    $cpg_output =~ s/sam$/txt/;
    $cpg_output =~ s/$/.txt/ unless ($cpg_output =~ /\.txt$/);
    $cpg_output = $output_dir . $cpg_output;
    push @sorting_files,$cpg_output;
    open ($fhs{CpG_context},'>',$cpg_output) or die "Failed to write to $cpg_output $! \n";
    print "Writing result file containing methylation information for C in CpG context to $cpg_output\n";

    unless ($no_header) {
      print {$fhs{CpG_context}} "Bismark methylation extractor version $version\n";
    }

    ### C in any other context than CpG
    $other_c_output =~ s/^/Non_CpG_context_/;
    $other_c_output =~ s/sam$/txt/;
    $other_c_output =~ s/$/.txt/ unless ($other_c_output =~ /\.txt$/);
    $other_c_output = $output_dir . $other_c_output;
    push @sorting_files,$other_c_output;
    open ($fhs{other_context},'>',$other_c_output) or die "Failed to write to $other_c_output $!\n";
    print "Writing result file containing methylation information for C in any other context to $other_c_output\n";

    unless ($no_header) {
      print {$fhs{other_context}} "Bismark methylation extractor version $version\n";
    }
  }

  ### if only --merge_non_CpG was specified we will write out 8 different output files, depending on where the (first) unique best alignment has been found
  elsif ($merge_non_CpG) {

    my $cpg_ot = my $cpg_ctot = my $cpg_ctob = my $cpg_ob = $output_filename;

    ### For cytosines in CpG context
    $cpg_ot =~ s/^/CpG_OT_/;
    $cpg_ot =~ s/sam$/txt/;
    $cpg_ot =~ s/$/.txt/ unless ($cpg_ot =~ /\.txt$/);
    $cpg_ot = $output_dir . $cpg_ot;
    push @sorting_files,$cpg_ot;
    open ($fhs{0}->{CpG},'>',$cpg_ot) or die "Failed to write to $cpg_ot $!\n";
    print "Writing result file containing methylation information for C in CpG context from the original top strand to $cpg_ot\n";

    unless($no_header){
      print {$fhs{0}->{CpG}} "Bismark methylation extractor version $version\n";
    }

    $cpg_ctot =~ s/^/CpG_CTOT_/;
    $cpg_ctot =~ s/sam$/txt/;
    $cpg_ctot =~ s/$/.txt/ unless ($cpg_ctot =~ /\.txt$/);
    $cpg_ctot = $output_dir . $cpg_ctot;
    push @sorting_files,$cpg_ctot;
    open ($fhs{1}->{CpG},'>',$cpg_ctot) or die "Failed to write to $cpg_ctot $!\n";
    print "Writing result file containing methylation information for C in CpG context from the complementary to original top strand to $cpg_ctot\n";

    unless($no_header){
      print {$fhs{1}->{CpG}} "Bismark methylation extractor version $version\n";
    }

    $cpg_ctob =~ s/^/CpG_CTOB_/;
    $cpg_ctob =~ s/sam$/txt/;
    $cpg_ctob =~ s/$/.txt/ unless ($cpg_ctob =~ /\.txt$/);
    $cpg_ctob = $output_dir . $cpg_ctob;
    push @sorting_files,$cpg_ctob;
    open ($fhs{2}->{CpG},'>',$cpg_ctob) or die "Failed to write to $cpg_ctob $!\n";
    print "Writing result file containing methylation information for C in CpG context from the complementary to original bottom strand to $cpg_ctob\n";

    unless($no_header){
      print {$fhs{2}->{CpG}}  "Bismark methylation extractor version $version\n";
    }

    $cpg_ob =~ s/^/CpG_OB_/;
    $cpg_ob =~ s/sam$/txt/;
    $cpg_ob =~ s/$/.txt/ unless ($cpg_ob =~ /\.txt$/);
    $cpg_ob = $output_dir . $cpg_ob;
    push @sorting_files,$cpg_ob;
    open ($fhs{3}->{CpG},'>',$cpg_ob) or die "Failed to write to $cpg_ob $!\n";
    print "Writing result file containing methylation information for C in CpG context from the original bottom strand to $cpg_ob\n\n";

    unless($no_header){
      print {$fhs{3}->{CpG}}  "Bismark methylation extractor version $version\n";
    }

    ### For cytosines in Non-CpG (CC, CT or CA) context
    my $other_c_ot = my $other_c_ctot = my $other_c_ctob = my $other_c_ob = $output_filename;

    $other_c_ot =~ s/^/Non_CpG_OT_/;
    $other_c_ot =~ s/sam$/txt/;
    $other_c_ot =~ s/$/.txt/ unless ($other_c_ot =~ /\.txt$/);
    $other_c_ot = $output_dir . $other_c_ot;
    push @sorting_files,$other_c_ot;
    open ($fhs{0}->{other_c},'>',$other_c_ot) or die "Failed to write to $other_c_ot $!\n";
    print "Writing result file containing methylation information for C in any other context from the original top strand to $other_c_ot\n";

    unless($no_header){
      print {$fhs{0}->{other_c}} "Bismark methylation extractor version $version\n";
    }

    $other_c_ctot =~ s/^/Non_CpG_CTOT_/;
    $other_c_ctot =~ s/sam$/txt/;
    $other_c_ctot =~ s/$/.txt/ unless ($other_c_ctot =~ /\.txt$/);
    $other_c_ctot = $output_dir . $other_c_ctot;
    push @sorting_files,$other_c_ctot;
    open ($fhs{1}->{other_c},'>',$other_c_ctot) or die "Failed to write to $other_c_ctot $!\n";
    print "Writing result file containing methylation information for C in any other context from the complementary to original top strand to $other_c_ctot\n";

    unless($no_header){
      print {$fhs{1}->{other_c}} "Bismark methylation extractor version $version\n";
    }

    $other_c_ctob =~ s/^/Non_CpG_CTOB_/;
    $other_c_ctob =~ s/sam$/txt/;
    $other_c_ctob =~ s/$/.txt/ unless ($other_c_ctob =~ /\.txt$/);
    $other_c_ctob = $output_dir . $other_c_ctob;
    push @sorting_files,$other_c_ctob;
    open ($fhs{2}->{other_c},'>',$other_c_ctob) or die "Failed to write to $other_c_ctob $!\n";
    print "Writing result file containing methylation information for C in any other context from the complementary to original bottom strand to $other_c_ctob\n";

    unless($no_header){
      print {$fhs{2}->{other_c}} "Bismark methylation extractor version $version\n";
    }

    $other_c_ob =~ s/^/Non_CpG_OB_/;
    $other_c_ob =~ s/sam$/txt/;
    $other_c_ob =~ s/$/.txt/ unless ($other_c_ob =~ /\.txt$/);
    $other_c_ob = $output_dir . $other_c_ob;
    push @sorting_files,$other_c_ob;
    open ($fhs{3}->{other_c},'>',$other_c_ob) or die "Failed to write to $other_c_ob $!\n";
    print "Writing result file containing methylation information for C in any other context from the original bottom strand to $other_c_ob\n\n";

    unless($no_header){
      print {$fhs{3}->{other_c}} "Bismark methylation extractor version $version\n";
    }
  }
  ### THIS SECTION IS THE DEFAULT (CpG, CHG and CHH context)

  ### if --comprehensive was specified we are only writing one file per context
  elsif ($full) {
    my $cpg_output = my $chg_output =  my $chh_output = $output_filename;
    ### C in CpG context
    $cpg_output =~ s/^/CpG_context_/;
    $cpg_output =~ s/sam$/txt/;
    $cpg_output =~ s/$/.txt/ unless ($cpg_output =~ /\.txt$/);
    $cpg_output = $output_dir . $cpg_output;
    push @sorting_files,$cpg_output;
    open ($fhs{CpG_context},'>',$cpg_output) or die "Failed to write to $cpg_output $! \n";
    print "Writing result file containing methylation information for C in CpG context to $cpg_output\n";

    unless($no_header){
      print {$fhs{CpG_context}} "Bismark methylation extractor version $version\n";
    }

    ### C in CHG context
    $chg_output =~ s/^/CHG_context_/;
    $chg_output =~ s/sam$/txt/;
    $chg_output =~ s/$/.txt/ unless ($chg_output =~ /\.txt$/);
    $chg_output = $output_dir . $chg_output;
    push @sorting_files,$chg_output;
    open ($fhs{CHG_context},'>',$chg_output) or die "Failed to write to $chg_output $!\n";
    print "Writing result file containing methylation information for C in CHG context to $chg_output\n";

    unless($no_header){
      print {$fhs{CHG_context}} "Bismark methylation extractor version $version\n";
    }

    ### C in CHH context
    $chh_output =~ s/^/CHH_context_/;
    $chh_output =~ s/sam$/txt/;
    $chh_output =~ s/$/.txt/ unless ($chh_output =~ /\.txt$/);
    $chh_output = $output_dir . $chh_output;
    push @sorting_files, $chh_output;
    open ($fhs{CHH_context},'>',$chh_output) or die "Failed to write to $chh_output $!\n";
    print "Writing result file containing methylation information for C in CHH context to $chh_output\n";

    unless($no_header){
      print {$fhs{CHH_context}} "Bismark methylation extractor version $version\n";
    }
  }
  ### else we will write out 12 different output files, depending on where the (first) unique best alignment was found
  else {
    my $cpg_ot = my $cpg_ctot = my $cpg_ctob = my $cpg_ob = $output_filename;

    ### For cytosines in CpG context
    $cpg_ot =~ s/^/CpG_OT_/;
    $cpg_ot =~ s/sam$/txt/;
    $cpg_ot =~ s/$/.txt/ unless ($cpg_ot =~ /\.txt$/);
    $cpg_ot = $output_dir . $cpg_ot;
    push @sorting_files,$cpg_ot;
    open ($fhs{0}->{CpG},'>',$cpg_ot) or die "Failed to write to $cpg_ot $!\n";
    print "Writing result file containing methylation information for C in CpG context from the original top strand to $cpg_ot\n";

    unless($no_header){
      print {$fhs{0}->{CpG}} "Bismark methylation extractor version $version\n";
    }

    $cpg_ctot =~ s/^/CpG_CTOT_/;
    $cpg_ctot =~ s/sam$/txt/;
    $cpg_ctot =~ s/$/.txt/ unless ($cpg_ctot =~ /\.txt$/);
    $cpg_ctot = $output_dir . $cpg_ctot;
    push @sorting_files,$cpg_ctot;
    open ($fhs{1}->{CpG},'>',$cpg_ctot) or die "Failed to write to $cpg_ctot $!\n";
    print "Writing result file containing methylation information for C in CpG context from the complementary to original top strand to $cpg_ctot\n";

    unless($no_header){
      print {$fhs{1}->{CpG}} "Bismark methylation extractor version $version\n";
    }

    $cpg_ctob =~ s/^/CpG_CTOB_/;
    $cpg_ctob =~ s/sam$/txt/;
    $cpg_ctob =~ s/$/.txt/ unless ($cpg_ctob =~ /\.txt$/);
    $cpg_ctob = $output_dir . $cpg_ctob;
    push @sorting_files,$cpg_ctob;
    open ($fhs{2}->{CpG},'>',$cpg_ctob) or die "Failed to write to $cpg_ctob $!\n";
    print "Writing result file containing methylation information for C in CpG context from the complementary to original bottom strand to $cpg_ctob\n";

    unless($no_header){
      print {$fhs{2}->{CpG}}  "Bismark methylation extractor version $version\n";
    }

    $cpg_ob =~ s/^/CpG_OB_/;
    $cpg_ob =~ s/sam$/txt/;
    $cpg_ob =~ s/$/.txt/ unless ($cpg_ob =~ /\.txt$/);
    $cpg_ob = $output_dir . $cpg_ob;
    push @sorting_files,$cpg_ob;
    open ($fhs{3}->{CpG},'>',$cpg_ob) or die "Failed to write to $cpg_ob $!\n";
    print "Writing result file containing methylation information for C in CpG context from the original bottom strand to $cpg_ob\n\n";

    unless($no_header){
      print {$fhs{3}->{CpG}}  "Bismark methylation extractor version $version\n";
    }

    ### For cytosines in CHG context
    my $chg_ot = my $chg_ctot = my $chg_ctob = my $chg_ob = $output_filename;

    $chg_ot =~ s/^/CHG_OT_/;
    $chg_ot =~ s/sam$/txt/;
    $chg_ot =~ s/$/.txt/ unless ($chg_ot =~ /\.txt$/);
    $chg_ot = $output_dir . $chg_ot;
    push @sorting_files,$chg_ot;
    open ($fhs{0}->{CHG},'>',$chg_ot) or die "Failed to write to $chg_ot $!\n";
    print "Writing result file containing methylation information for C in CHG context from the original top strand to $chg_ot\n";

    unless($no_header){
      print {$fhs{0}->{CHG}} "Bismark methylation extractor version $version\n";
    }

    $chg_ctot =~ s/^/CHG_CTOT_/;
    $chg_ctot =~ s/sam$/txt/;
    $chg_ctot =~ s/$/.txt/ unless ($chg_ctot =~ /\.txt$/);
    $chg_ctot = $output_dir . $chg_ctot;
    push @sorting_files,$chg_ctot;
    open ($fhs{1}->{CHG},'>',$chg_ctot) or die "Failed to write to $chg_ctot $!\n";
    print "Writing result file containing methylation information for C in CHG context from the complementary to original top strand to $chg_ctot\n";

    unless($no_header){
      print {$fhs{1}->{CHG}} "Bismark methylation extractor version $version\n";
    }

    $chg_ctob =~ s/^/CHG_CTOB_/;
    $chg_ctob =~ s/sam$/txt/;
    $chg_ctob =~ s/$/.txt/ unless ($chg_ctob =~ /\.txt$/);
    $chg_ctob = $output_dir . $chg_ctob;
    push @sorting_files,$chg_ctob;
    open ($fhs{2}->{CHG},'>',$chg_ctob) or die "Failed to write to $chg_ctob $!\n";
    print "Writing result file containing methylation information for C in CHG context from the complementary to original bottom strand to $chg_ctob\n";

    unless($no_header){
      print {$fhs{2}->{CHG}} "Bismark methylation extractor version $version\n";
    }

    $chg_ob =~ s/^/CHG_OB_/;
    $chg_ob =~ s/sam$/txt/;
    $chg_ob =~ s/$/.txt/ unless ($chg_ob =~ /\.txt$/);
    $chg_ob = $output_dir . $chg_ob;
    push @sorting_files,$chg_ob;
    open ($fhs{3}->{CHG},'>',$chg_ob) or die "Failed to write to $chg_ob $!\n";
    print "Writing result file containing methylation information for C in CHG context from the original bottom strand to $chg_ob\n\n";

    unless($no_header){
      print {$fhs{3}->{CHG}} "Bismark methylation extractor version $version\n";
    }

    ### For cytosines in CHH context
    my $chh_ot = my $chh_ctot = my $chh_ctob = my $chh_ob = $output_filename;

    $chh_ot =~ s/^/CHH_OT_/;
    $chh_ot =~ s/sam$/txt/;
    $chh_ot =~ s/$/.txt/ unless ($chh_ot =~ /\.txt$/);
    $chh_ot = $output_dir . $chh_ot;
    push @sorting_files,$chh_ot;
    open ($fhs{0}->{CHH},'>',$chh_ot) or die "Failed to write to $chh_ot $!\n";
    print "Writing result file containing methylation information for C in CHH context from the original top strand to $chh_ot\n";

    unless($no_header){
      print {$fhs{0}->{CHH}} "Bismark methylation extractor version $version\n";
    }

    $chh_ctot =~ s/^/CHH_CTOT_/;
    $chh_ctot =~ s/sam$/txt/;
    $chh_ctot =~ s/$/.txt/ unless ($chh_ctot =~ /\.txt$/);
    $chh_ctot = $output_dir . $chh_ctot;
    push @sorting_files,$chh_ctot;
    open ($fhs{1}->{CHH},'>',$chh_ctot) or die "Failed to write to $chh_ctot $!\n";
    print "Writing result file containing methylation information for C in CHH context from the complementary to original top strand to $chh_ctot\n";

    unless($no_header){
      print {$fhs{1}->{CHH}} "Bismark methylation extractor version $version\n";
    }

    $chh_ctob =~ s/^/CHH_CTOB_/;
    $chh_ctob =~ s/sam$/txt/;
    $chh_ctob =~ s/$/.txt/ unless ($chh_ctob =~ /\.txt$/);
    $chh_ctob = $output_dir . $chh_ctob;
    push @sorting_files,$chh_ctob;
    open ($fhs{2}->{CHH},'>',$chh_ctob) or die "Failed to write to $chh_ctob $!\n";
    print "Writing result file containing methylation information for C in CHH context from the complementary to original bottom strand to $chh_ctob\n";

    unless($no_header){
      print {$fhs{2}->{CHH}} "Bismark methylation extractor version $version\n";
    }

    $chh_ob =~ s/^/CHH_OB_/;
    $chh_ob =~ s/sam$/txt/;
    $chh_ob =~ s/$/.txt/ unless ($chh_ob =~ /\.txt$/);
    $chh_ob = $output_dir . $chh_ob;
    push @sorting_files,$chh_ob;
    open ($fhs{3}->{CHH},'>',$chh_ob) or die "Failed to write to $chh_ob $!\n";
    print "Writing result file containing methylation information for C in CHH context from the original bottom strand to $chh_ob\n\n";

    unless($no_header){
      print {$fhs{3}->{CHH}} "Bismark methylation extractor version $version\n";
    }
  }

  my $methylation_call_strings_processed = 0;
  my $line_count = 0;

  ### proceeding differently now for single-end or paired-end Bismark files

  ### PROCESSING SINGLE-END RESULT FILES
  if ($single) {

    ### also proceeding differently now for SAM format or vanilla Bismark format files
    if ($vanilla) {		# old vanilla Bismark output format
      while (<IN>) {
	++$line_count;
	warn "Processed lines: $line_count\n" if ($line_count%500000==0);
	
	### $seq here is the chromosomal sequence (to use for the repeat analysis for example)
	my ($id,$strand,$chrom,$start,$seq,$meth_call,$read_conversion,$genome_conversion) = (split("\t"))[0,1,2,3,6,7,8,9];
	
	### we need to remove 2 bp of the genomic sequence as we were extracting read + 2bp long fragments to make a methylation call at the first or
	### last position
	chomp $genome_conversion;

	my $index;
	if ($meth_call) {

	  if ($read_conversion eq 'CT' and $genome_conversion eq 'CT') { ## original top strand
	    $index = 0;
	  } elsif ($read_conversion eq 'GA' and $genome_conversion eq 'CT') { ## complementary to original top strand
	    $index = 1;
	  } elsif ($read_conversion eq 'CT' and $genome_conversion eq 'GA') { ## original bottom strand
	    $index = 3;
	  } elsif ($read_conversion eq 'GA' and $genome_conversion eq 'GA') { ## complementary to original bottom strand
	    $index = 2;
	  } else {
	    die "Unexpected combination of read and genome conversion: '$read_conversion' / '$genome_conversion'\n";
	  }
	
	  ### Clipping off the first <int> number of bases from the methylation call string as specified with --ignore <int>
	  if ($ignore) {
	    $meth_call = substr($meth_call,$ignore,length($meth_call)-$ignore);	
	
	    ### If we are clipping off some bases at the start we need to adjust the start position of the alignments accordingly!
	    if ($strand eq '+') {
	      $start += $ignore;
	    } elsif ($strand eq '-') {
	      $start += length($meth_call)-1; ## $meth_call is already shortened!
	    } else {
	      die "Alignment did not have proper strand information: $strand\n";
	    }
	  }
	  ### printing out the methylation state of every C in the read
	  print_individual_C_methylation_states_single_end($meth_call,$chrom,$start,$id,$strand,$index);
	
	  ++$methylation_call_strings_processed; # 1 per single-end result
	}
      }
    } else {		  # processing single-end SAM format (default)
      while (<IN>) {
	### SAM format can either start with header lines (starting with @) or start with alignments directly
	if (/^\@/) {	     # skipping header lines (starting with @)
	  warn "skipping SAM header line:\t$_";
	  next;
	}

	++$line_count;
	warn "Processed lines: $line_count\n" if ($line_count%500000==0);
	
	# example read in SAM format
	# 1_R1/1	67	5	103172224	255	40M	=	103172417	233	AATATTTTTTTTATTTTAAAATGTGTATTGATTTAAATTT	IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII	NM:i:4	XX:Z:4T1T24TT7	XM:Z:....h.h........................hh.......	XR:Z:CT	XG:Z:CT
	###

	# < 0.7.6 my ($id,$chrom,$start,$meth_call,$read_conversion,$genome_conversion) = (split("\t"))[0,2,3,13,14,15];
	# < 0.7.6 $meth_call =~ s/^XM:Z://;
	# < 0.7.6 $read_conversion =~ s/^XR:Z://;
	# < 0.7.6 $genome_conversion =~ s/^XG:Z://;	

	my ($id,$chrom,$start,$cigar) = (split("\t"))[0,2,3,5];

	### detecting the following SAM flags in case the SAM entry was shuffled by CRAM or Goby compression/decompression
	my $meth_call;	  ### Thanks to Zachary Zeno for this solution
	my $read_conversion;
	my $genome_conversion;
	
	while ( /(XM|XR|XG):Z:([^\t]+)/g ) {
	  my $tag = $1;
	  my $value = $2;

	  if ($tag eq "XM") {
	    $meth_call = $value;
	    $meth_call =~ s/\r//;
	  } elsif ($tag eq "XR") {
	    $read_conversion = $value;
	    $read_conversion =~ s/\r//;
	  } elsif ($tag eq "XG") {
	    $genome_conversion = $value;
	    $genome_conversion =~ s/\r//;
	  }
	}

	my $strand;
	chomp $genome_conversion;
	# print "$meth_call\n$read_conversion\n$genome_conversion\n";
	
	my $index;
	if ($meth_call) {
	  if ($read_conversion eq 'CT' and $genome_conversion eq 'CT') { ## original top strand
	    $index = 0;
	    $strand = '+';
	  } elsif ($read_conversion eq 'GA' and $genome_conversion eq 'CT') { ## complementary to original top strand
	    $index = 1;
	    $strand = '-';
	  } elsif ($read_conversion eq 'GA' and $genome_conversion eq 'GA') { ## complementary to original bottom strand
	    $index = 2;
	    $strand = '+';
	  } elsif ($read_conversion eq 'CT' and $genome_conversion eq 'GA') { ## original bottom strand
	    $index = 3;
	    $strand = '-';
	  } else {
	    die "Unexpected combination of read and genome conversion: '$read_conversion' / '$genome_conversion'\n";
	  }
	
	  ### If the read is in SAM format we need to reverse the methylation call if the read has been reverse-complemented for the output
	  if ($strand eq '-') {
	    $meth_call = reverse $meth_call;
	  }
	
	  ### Clipping off the first <int> number of bases from the methylation call string as specified with --ignore <int>
	  if ($ignore) {
	    # print "\n\n$meth_call\n";
	    $meth_call = substr($meth_call,$ignore,length($meth_call)-$ignore);	
	    # print "$meth_call\n";
	    ### If we are ignoring a part of the sequence we also need to adjust the cigar string accordingly

	    my @len = split (/\D+/,$cigar); # storing the length per operation
	    my @ops = split (/\d+/,$cigar); # storing the operation
	    shift @ops;		# remove the empty first element
	    die "CIGAR string contained a non-matching number of lengths and operations\n" unless (scalar @len == scalar @ops);
		
	    my @comp_cigar; # building an array with all CIGAR operations
	    foreach my $index (0..$#len) {
	      foreach (1..$len[$index]) {
		# print  "$ops[$index]";
		push @comp_cigar, $ops[$index];
	      }
	    }
	    # print "original CIGAR: $cigar\n";
	    # print "original CIGAR: @comp_cigar\n";

	    ### If we are clipping off some bases at the start we need to adjust the start position of the alignments accordingly!
	    if ($strand eq '+') {
	
	      my $D_count = 0; # counting all deletions that affect the ignored genomic position, i.e. Deletions and insertions
	      my $I_count = 0;

	      for (1..$ignore) {
		my $op = shift @comp_cigar; # adjusting composite CIGAR string by removing $ignore operations from the start
		# print "$_ deleted $op\n";

		while ($op eq 'D') { # repeating this for deletions (D)
		  $D_count++;
		  $op = shift @comp_cigar;
		  # print "$_ deleted $op\n";
		}
		if ($op eq 'I') { # adjusting the genomic position for insertions (I)
		  $I_count++;
		}
	      }
	      $start += $ignore + $D_count - $I_count;
	      # print "start $start\t ignore: $ignore\t D count: $D_count I_count: $I_count\n";
	    } elsif ($strand eq '-') {

	      for (1..$ignore) {
		my $op = pop @comp_cigar; # adjusting composite CIGAR string by removing $ignore operations, here the last value of the array
		while ($op eq 'D') { # repeating this for deletions (D)
		  $op = pop @comp_cigar;
		}
	      }

	      ### For reverse strand alignments we need to determine the number of matching bases (M) or deletions (D) in the read from the CIGAR
	      ### string to be able to work out the starting position of the read which is on the 3' end of the sequence
	      my $MD_count = 0;	# counting all operations that affect the genomic position, i.e. M and D. Insertions do not affect the start position
	      foreach (@comp_cigar) {
		++$MD_count if ($_ eq 'M' or $_ eq 'D');
	      }
	      $start += $MD_count - 1;
	    }
	
	    ### reconstituting shortened CIGAR string
	    my $new_cigar;
	    my $count = 0;
	    my $last_op;
	    # print "ignore adjusted: @comp_cigar\n";
	    foreach my $op (@comp_cigar) {
	      unless (defined $last_op){
		$last_op = $op;
		++$count;
		next;
	      }
	      if ($last_op eq $op) {
		++$count;
	      } else {
		$new_cigar .= "$count$last_op";
		$last_op = $op;
		$count = 1;
	      }
	    }
	    $new_cigar .= "$count$last_op"; # appending the last operation and count
	    $cigar = $new_cigar;
	    # print "ignore adjusted scalar: $cigar\n";
	  }
	}
	### printing out the methylation state of every C in the read
	print_individual_C_methylation_states_single_end($meth_call,$chrom,$start,$id,$strand,$index,$cigar);
	
	++$methylation_call_strings_processed; # 1 per single-end result
      }
    }
  }

  ### PROCESSING PAIRED-END RESULT FILES
  elsif ($paired) {

    ### proceeding differently now for SAM format or vanilla Bismark format files
    if ($vanilla) {	# old vanilla Bismark paired-end output format
      while (<IN>) {
	++$line_count;
	warn "processed line: $line_count\n" if ($line_count%500000==0);

	### $seq here is the chromosomal sequence (to use for the repeat analysis for example)
	my ($id,$strand,$chrom,$start_read_1,$end_read_2,$seq_1,$meth_call_1,$seq_2,$meth_call_2,$first_read_conversion,$genome_conversion) = (split("\t"))[0,1,2,3,4,6,7,9,10,11,12,13];

	my $index;
	chomp $genome_conversion;
	
	if ($first_read_conversion eq 'CT' and $genome_conversion eq 'CT') {
	  $index = 0;		## this is OT
	} elsif ($first_read_conversion eq 'GA' and $genome_conversion eq 'GA') {
	  $index = 2;		## this is CTOB!!!
	} elsif ($first_read_conversion eq 'GA' and $genome_conversion eq 'CT') {
	  $index = 1;		## this is CTOT!!!
	} elsif ($first_read_conversion eq 'CT' and $genome_conversion eq 'GA') {
	  $index = 3;		## this is OB
	} else {
	  die "Unexpected combination of read and genome conversion: $first_read_conversion / $genome_conversion\n";
	}
	
	if ($meth_call_1 and $meth_call_2) {
	  ### Clipping off the first <int> number of bases from the methylation call strings as specified with '--ignore <int>'
	  if ($ignore) {
	    $meth_call_1 = substr($meth_call_1,$ignore,length($meth_call_1)-$ignore);
	    $meth_call_2 = substr($meth_call_2,$ignore,length($meth_call_2)-$ignore);

	    ### we also need to adjust the start and end positions of the alignments accordingly if '--ignore' was specified
	    $start_read_1 += $ignore;
	    $end_read_2   -= $ignore;
	  }
	  my $end_read_1;
	  my $start_read_2;

	  if ($strand eq '+') {

	    $end_read_1 = $start_read_1+length($meth_call_1)-1;
	    $start_read_2 = $end_read_2-length($meth_call_2)+1;
		
	    ## we first pass the first read which is in + orientation on the forward strand
	    print_individual_C_methylation_states_paired_end_files($meth_call_1,$chrom,$start_read_1,$id,'+',$index,0,0);
	
	    # we next pass the second read which is in - orientation on the reverse strand
	    ### if --no_overlap was specified we also pass the end of read 1. If read 2 starts to overlap with read 1 we can stop extracting methylation calls from read 2
	    print_individual_C_methylation_states_paired_end_files($meth_call_2,$chrom,$end_read_2,$id,'-',$index,$no_overlap,$end_read_1);
	  } else {
	
	    $end_read_1 = $start_read_1+length($meth_call_2)-1;	# read 1 is the second reported read!
	    $start_read_2 = $end_read_2-length($meth_call_1)+1;	# read 2 is the first reported read!

	    ## we first pass the first read which is in - orientation on the reverse strand
	    print_individual_C_methylation_states_paired_end_files($meth_call_1,$chrom,$end_read_2,$id,'-',$index,0,0);

	    # we next pass the second read which is in + orientation on the forward strand
	    ### if --no_overlap was specified we also pass the end of read 2. If read 2 starts to overlap with read 1 we will stop extracting methylation calls from read 2
	    print_individual_C_methylation_states_paired_end_files($meth_call_2,$chrom,$start_read_1,$id,'+',$index,$no_overlap,$start_read_2);
	  }
	
	  $methylation_call_strings_processed += 2; # paired-end = 2 methylation calls
	}	
      }
    } else {	      # Bismark paired-end SAM output format (default)
      while (<IN>) {
	### SAM format can either start with header lines (starting with @) or start with alignments directly
	if (/^\@/) {	     # skipping header lines (starting with @)
	  warn "skipping SAM header line:\t$_";
	  next;
	}
	
	++$line_count;
	warn "Processed lines: $line_count\n" if ($line_count%500000==0);
	
	# example paired-end reads in SAM format (2 consecutive lines)
	# 1_R1/1	67	5	103172224	255	40M	=	103172417	233	AATATTTTTTTTATTTTAAAATGTGTATTGATTTAAATTT	IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII	NM:i:4	XX:Z:4T1T24TT7	XM:Z:....h.h........................hh.......	XR:Z:CT	XG:Z:CT
	# 1_R1/2	131	5	103172417	255	40M	=	103172224	-233	TATTTTTTTTTAGAGTATTTTTTAATGGTTATTAGATTTT	IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII	NM:i:6	XX:Z:T5T1T9T9T7T3	XM:Z:h.....h.h.........h.........h.......h...	XR:Z:GA	XG:Z:CT
	
	#  < version 0.7.6 my ($id_1,$chrom,$start_read_1,$meth_call_1,$first_read_conversion,$genome_conversion) = (split("\t"))[0,2,3,13,14,15];

	my ($id_1,$chrom,$start_read_1,$cigar_1) = (split("\t"))[0,2,3,5]; ### detecting the following SAM flags in case the SAM entry was shuffled by CRAM or Goby compression/decompression
	my $meth_call_1;
	my $first_read_conversion;
	my $genome_conversion;
	
	while ( /(XM|XR|XG):Z:([^\t]+)/g ) {
	  my $tag = $1;
	  my $value = $2;

	  if ($tag eq "XM") {
	    $meth_call_1 = $value;
	    $meth_call_1 =~ s/\r//;
	  } elsif ($tag eq "XR") {
	    $first_read_conversion = $value;
	    $first_read_conversion =~ s/\r//;
	  } elsif ($tag eq "XG") {
	    $genome_conversion = $value;
	    $genome_conversion =~ s/\r//;
	  }
	}

	$_ = <IN>;		# reading in the paired read

	# < version 0.7.6 my ($id_2,$start_read_2,$meth_call_2,$second_read_conversion) = (split("\t"))[0,3,13,14];
	# < version 0.7.6 $meth_call_1 =~ s/^XM:Z://;
	# < version 0.7.6 $meth_call_2 =~ s/^XM:Z://;
	# < version 0.7.6 $first_read_conversion =~ s/^XR:Z://;
	# < version 0.7.6 $second_read_conversion =~ s/^XR:Z://;

	my ($id_2,$start_read_2,$cigar_2) = (split("\t"))[0,3,5]; ### detecting the following SAM flags in case the SAM entry was shuffled by CRAM or Goby compression/decompression

	my $meth_call_2;
	my $second_read_conversion;
	
	while ( /(XM|XR):Z:([^\t]+)/g ) {
	  my $tag = $1;
	  my $value = $2;

	  if ($tag eq "XM") {
	    $meth_call_2 = $value;
	    $meth_call_2 =~ s/\r//;
	  } elsif ($tag eq "XR") {
	    $second_read_conversion = $value;
	    $second_read_conversion = s/\r//;
	  }
	}
	
	# < version 0.7.6 $genome_conversion =~ s/^XG:Z://;	
	chomp $genome_conversion; # in case it captured a new line character	

	# print join ("\t",$meth_call_1,$meth_call_2,$first_read_conversion,$second_read_conversion,$genome_conversion),"\n";

	my $index;
	my $strand;

	if ($first_read_conversion eq 'CT' and $genome_conversion eq 'CT') {
	  $index = 0;		## this is OT
	  $strand = '+';
	} elsif ($first_read_conversion eq 'GA' and $genome_conversion eq 'CT') {
	  $index = 1;		## this is CTOT
	  $strand = '-';
	} elsif ($first_read_conversion eq 'GA' and $genome_conversion eq 'GA') {
	  $index = 2;		## this is CTOB
	  $strand = '+';
	} elsif ($first_read_conversion eq 'CT' and $genome_conversion eq 'GA') {
	  $index = 3;		## this is OB
	  $strand = '-';
	} else {
	  die "Unexpected combination of read and genome conversion: $first_read_conversion / $genome_conversion\n";
	}

	### reversing the methylation call of the read that was reverse-complemented
	if ($strand eq '+') {
	  $meth_call_2 = reverse $meth_call_2;
	} else {
	  $meth_call_1 = reverse $meth_call_1;
	}

	if ($meth_call_1 and $meth_call_2) {

	  my $end_read_1;
	
	  ### READ 1
	  my @len_1 = split (/\D+/,$cigar_1); # storing the length per operation
	  my @ops_1 = split (/\d+/,$cigar_1); # storing the operation
	  shift @ops_1;		# remove the empty first element
	  die "CIGAR string contained a non-matching number of lengths and operations\n" unless (scalar @len_1 == scalar @ops_1);
	
	  my @comp_cigar_1; # building an array with all CIGAR operations
	  foreach my $index (0..$#len_1) {
	    foreach (1..$len_1[$index]) {
	      # print  "$ops_1[$index]";
	      push @comp_cigar_1, $ops_1[$index];
	    }
	  }
	  # print "original CIGAR read 1: $cigar_1\n";
	  # print "original CIGAR read 1: @comp_cigar_1\n";

	  ### READ 2
	  my @len_2 = split (/\D+/,$cigar_2); # storing the length per operation
	  my @ops_2 = split (/\d+/,$cigar_2); # storing the operation
	  shift @ops_2;		# remove the empty first element
	  die "CIGAR string contained a non-matching number of lengths and operations\n" unless (scalar @len_2 == scalar @ops_2);
	  my @comp_cigar_2; # building an array with all CIGAR operations for read 2
	  foreach my $index (0..$#len_2) {
	    foreach (1..$len_2[$index]) {
	      # print  "$ops_2[$index]";
	      push @comp_cigar_2, $ops_2[$index];
	    }
	  }
	  # print "original CIGAR read 2: $cigar_2\n";
	  # print "original CIGAR read 2: @comp_cigar_2\n";
	
	  if ($ignore) {
	    ### Clipping off the first <int> number of bases from the methylation call strings as specified with '--ignore <int>'	
	    ### the methylation calls have already been reversed where necessary
	    $meth_call_1 = substr($meth_call_1,$ignore,length($meth_call_1)-$ignore);
	    $meth_call_2 = substr($meth_call_2,$ignore,length($meth_call_2)-$ignore);

	    ### If we are ignoring a part of the sequence we also need to adjust the cigar string accordingly

	    if ($strand eq '+') {
		
	      ### if the (read 1) strand information is '+', read 1 needs to be trimmed from the start
	      my $D_count_1 = 0; # counting all deletions that affect the ignored genomic position for read 1, i.e. Deletions and insertions
	      my $I_count_1 = 0;

	      for (1..$ignore) {
		my $op = shift @comp_cigar_1; # adjusting composite CIGAR string of read 1 by removing $ignore operations from the start
		# print "$_ deleted $op\n";
		
		while ($op eq 'D') { # repeating this for deletions (D)
		  $D_count_1++;
		  $op = shift @comp_cigar_1;
		  # print "$_ deleted $op\n";
		}
		if ($op eq 'I') { # adjusting the genomic position for insertions (I)
		  $I_count_1++;
		}
	      }
		
	      $start_read_1 += $ignore + $D_count_1 - $I_count_1;
	      # print "start read 1 $start_read_1\t ignore: $ignore\t D count 1: $D_count_1\tI_count 1: $I_count_1\n";
	
	      ### if the (read 1) strand information is '+', read 2 needs to be trimmed from the back

	      for (1..$ignore) {
		my $op = pop @comp_cigar_2; # adjusting composite CIGAR string by removing $ignore operations, here the last value of the array
		while ($op eq 'D') { # repeating this for deletions (D)
		  $op = pop @comp_cigar_2;
		}
	      }
	      # the start position of reads mapping to the reverse strand is being adjusted further below
	    } elsif ($strand eq '-') {
	
	      ### if the (read 1) strand information is '-', read 1 needs to be trimmed from the back
	      for (1..$ignore) {
		my $op = pop @comp_cigar_1; # adjusting composite CIGAR string by removing $ignore operations, here the last value of the array
		while ($op eq 'D') { # repeating this for deletions (D)
		  $op = pop @comp_cigar_1;
		}
	      }
	      # the start position of reads mapping to the reverse strand is being adjusted further below

	      ### if the (read 1) strand information is '-', read 2 needs to be trimmed from the start
	      my $D_count_2 = 0; # counting all deletions that affect the ignored genomic position for read 2, i.e. Deletions and insertions
	      my $I_count_2 = 0;
		
	      for (1..$ignore) {
		my $op = shift @comp_cigar_2; # adjusting composite CIGAR string of read 2 by removing $ignore operations from the start
		# print "$_ deleted $op\n";
		
		while ($op eq 'D') { # repeating this for deletions (D)
		  $D_count_2++;
		  $op = shift @comp_cigar_2;
		  # print "$_ deleted $op\n";
		}
		if ($op eq 'I') { # adjusting the genomic position for insertions (I)
		  $I_count_2++;
		}
	      }
		
	      $start_read_2 += $ignore + $D_count_2 - $I_count_2;
	      # print "start read 2 $start_read_2\t ignore: $ignore\t D count 2: $D_count_2\tI_count 2: $I_count_2\n";
	
	    }
	
	    ### reconstituting shortened CIGAR string 1
	    my $new_cigar_1;
	    my $count_1 = 0;
	    my $last_op_1;
	    # print "ignore adjusted CIGAR 1: @comp_cigar_1\n";
	    foreach my $op (@comp_cigar_1) {
	      unless (defined $last_op_1){
		$last_op_1 = $op;
		++$count_1;
		next;
	      }
	      if ($last_op_1 eq $op) {
		++$count_1;
	      } else {
		$new_cigar_1 .= "$count_1$last_op_1";
		$last_op_1 = $op;
		$count_1 = 1;
	      }
	    }
	    $new_cigar_1 .= "$count_1$last_op_1"; # appending the last operation and count
	    $cigar_1 = $new_cigar_1;
	    # print "ignore adjusted CIGAR 1 scalar: $cigar_1\n";

	    ### reconstituting shortened CIGAR string 2
	    my $new_cigar_2;
	    my $count_2 = 0;
	    my $last_op_2;
	    # print "ignore adjusted CIGAR 2: @comp_cigar_2\n";
	    foreach my $op (@comp_cigar_2) {
	      unless (defined $last_op_2){
		$last_op_2 = $op;
		++$count_2;
		next;
	      }
	      if ($last_op_2 eq $op) {
		++$count_2;
	      } else {
		$new_cigar_2 .= "$count_2$last_op_2";
		$last_op_2 = $op;
		$count_2 = 1;
	      }
	    }
	    $new_cigar_2 .= "$count_2$last_op_2"; # appending the last operation and count
	    $cigar_2 = $new_cigar_2;
	    # print "ignore adjusted CIGAR 2 scalar: $cigar_2\n";

	  }
	
	  if ($strand eq '+') {
	    ### adjusting the start position for all reads mapping to the reverse strand, in this case read 2
	    @comp_cigar_2  = reverse@comp_cigar_2; # the CIGAR string needs to be reversed for all reads aligning to the reverse strand, too
	    # print "reverse: @comp_cigar_2\n";
	
	    my $MD_count_1 = 0;
	    foreach (@comp_cigar_1) {
	      ++$MD_count_1 if ($_ eq 'M' or $_ eq 'D'); # Matching bases or deletions affect the genomic position of the 3' ends of reads, insertions don't
	    }

	    my $MD_count_2 = 0;
	    foreach (@comp_cigar_2) {
	      ++$MD_count_2 if ($_ eq 'M' or $_ eq 'D'); # Matching bases or deletions affect the genomic position of the 3' ends of reads, insertions don't
	    }

	    $end_read_1 = $start_read_1 + $MD_count_1 - 1;
	    $start_read_2 += $MD_count_2 - 1; ## Passing on the start position on the reverse strand
	  } else {
	    ### adjusting the start position for all reads mapping to the reverse strand, in this case read 1
	
	    @comp_cigar_1  = reverse@comp_cigar_1; # the CIGAR string needs to be reversed for all reads aligning to the reverse strand, too
	    # print "reverse: @comp_cigar_1\n";

	    my $MD_count_1 = 0;
	    foreach (@comp_cigar_1) {
	      ++$MD_count_1 if ($_ eq 'M' or $_ eq 'D'); # Matching bases or deletions affect the genomic position of the 3' ends of reads, insertions don't
	    }

	    $end_read_1 = $start_read_1;	
	    $start_read_1 +=  $MD_count_1 - 1; ### Passing on the start position on the reverse strand

	  }

	  if ($strand eq '+') {
	    ## we first pass the first read which is in + orientation on the forward strand
	    print_individual_C_methylation_states_paired_end_files($meth_call_1,$chrom,$start_read_1,$id_1,'+',$index,0,0,$cigar_1);
	
	    # we next pass the second read which is in - orientation on the reverse strand
	    ### if --no_overlap was specified we also pass the end of read 1. If read 2 starts to overlap with read 1 we can stop extracting methylation calls from read 2
	    print_individual_C_methylation_states_paired_end_files($meth_call_2,$chrom,$start_read_2,$id_2,'-',$index,$no_overlap,$end_read_1,$cigar_2);
	  } else {
	    ## we first pass the first read which is in - orientation on the reverse strand
	    print_individual_C_methylation_states_paired_end_files($meth_call_1,$chrom,$start_read_1,$id_1,'-',$index,0,0,$cigar_1);
	
	    # we next pass the second read which is in + orientation on the forward strand
	    ### if --no_overlap was specified we also pass the end of read 1. If read 2 starts to overlap with read 1 we will stop extracting methylation calls from read 2
	    print_individual_C_methylation_states_paired_end_files($meth_call_2,$chrom,$start_read_2,$id_2,'+',$index,$no_overlap,$end_read_1,$cigar_2);
	  }
	
	  $methylation_call_strings_processed += 2; # paired-end = 2 methylation calls
	}	
      }
    }
  } else {
    die "Single-end or paired-end reads not specified properly\n";
  }

  print "\n\nProcessed $line_count lines from $filename in total\n";
  print "Total number of methylation call strings processed: $methylation_call_strings_processed\n\n";
  if ($report) {
    print REPORT "Total number of methylation call strings processed: $methylation_call_strings_processed\n\n";
  }
  print_splitting_report ();
}



sub print_splitting_report{

  ### Calculating methylation percentages if applicable

  my $percent_meCpG;
  if (($counting{total_meCpG_count}+$counting{total_unmethylated_CpG_count}) > 0){
    $percent_meCpG = sprintf("%.1f",100*$counting{total_meCpG_count}/($counting{total_meCpG_count}+$counting{total_unmethylated_CpG_count}));
  }

  my $percent_meCHG;
  if (($counting{total_meCHG_count}+$counting{total_unmethylated_CHG_count}) > 0){
    $percent_meCHG = sprintf("%.1f",100*$counting{total_meCHG_count}/($counting{total_meCHG_count}+$counting{total_unmethylated_CHG_count}));
  }

  my $percent_meCHH;
  if (($counting{total_meCHH_count}+$counting{total_unmethylated_CHH_count}) > 0){
    $percent_meCHH = sprintf("%.1f",100*$counting{total_meCHH_count}/($counting{total_meCHH_count}+$counting{total_unmethylated_CHH_count}));
  }

  my $percent_non_CpG_methylation;
  if ($merge_non_CpG){
    if ( ($counting{total_meCHH_count}+$counting{total_unmethylated_CHH_count}+$counting{total_meCHG_count}+$counting{total_unmethylated_CHG_count}) > 0){
      $percent_non_CpG_methylation = sprintf("%.1f",100* ( $counting{total_meCHH_count}+$counting{total_meCHG_count} ) / ( $counting{total_meCHH_count}+$counting{total_unmethylated_CHH_count}+$counting{total_meCHG_count}+$counting{total_unmethylated_CHG_count} ) );
    }
  }

  if ($report){
    ### detailed information about Cs analysed
    print REPORT "Final Cytosine Methylation Report\n",'='x33,"\n";

    my $total_number_of_C = $counting{total_meCHG_count}+$counting{total_meCHH_count}+$counting{total_meCpG_count}+$counting{total_unmethylated_CHG_count}+$counting{total_unmethylated_CHH_count}+$counting{total_unmethylated_CpG_count};
    print REPORT "Total number of C's analysed:\t$total_number_of_C\n\n";

    print REPORT "Total methylated C's in CpG context:\t$counting{total_meCpG_count}\n";
    print REPORT "Total methylated C's in CHG context:\t$counting{total_meCHG_count}\n";
    print REPORT "Total methylated C's in CHH context:\t$counting{total_meCHH_count}\n\n";

    print REPORT "Total C to T conversions in CpG context:\t$counting{total_unmethylated_CpG_count}\n";
    print REPORT "Total C to T conversions in CHG context:\t$counting{total_unmethylated_CHG_count}\n";
    print REPORT "Total C to T conversions in CHH context:\t$counting{total_unmethylated_CHH_count}\n\n";

    ### calculating methylated CpG percentage if applicable
    if ($percent_meCpG){
      print REPORT "C methylated in CpG context:\t${percent_meCpG}%\n";
    }
    else{
      print REPORT "Can't determine percentage of methylated Cs in CpG context if value was 0\n";
    }

    ### 2-Context Output
    if ($merge_non_CpG){
      if ($percent_non_CpG_methylation){
	print REPORT "C methylated in non-CpG context:\t${percent_non_CpG_methylation}%\n\n\n";
      }
      else{
	print REPORT "Can't determine percentage of methylated Cs in non-CpG context if value was 0\n\n\n";
      }
    }

    ### 3 Context Output
    else{
      ### calculating methylated CHG percentage if applicable
      if ($percent_meCHG){
	print REPORT "C methylated in CHG context:\t${percent_meCHG}%\n";
      }
      else{
	print REPORT "Can't determine percentage of methylated Cs in CHG context if value was 0\n";
      }

      ### calculating methylated CHH percentage if applicable
      if ($percent_meCHH){
	print REPORT "C methylated in CHH context:\t${percent_meCHH}%\n\n\n";
      }
      else{
	print REPORT "Can't determine percentage of methylated Cs in CHH context if value was 0\n\n\n";
      }
    }
  }

  ### detailed information about Cs analysed for on-screen report
  print "Final Cytosine Methylation Report\n",'='x33,"\n";

  my $total_number_of_C = $counting{total_meCHG_count}+$counting{total_meCHH_count}+$counting{total_meCpG_count}+$counting{total_unmethylated_CHG_count}+$counting{total_unmethylated_CHH_count}+$counting{total_unmethylated_CpG_count};
  print "Total number of C's analysed:\t$total_number_of_C\n\n";

  print "Total methylated C's in CpG context:\t$counting{total_meCpG_count}\n";
  print "Total methylated C's in CHG context:\t$counting{total_meCHG_count}\n";
  print "Total methylated C's in CHH context:\t$counting{total_meCHH_count}\n\n";

  print "Total C to T conversions in CpG context:\t$counting{total_unmethylated_CpG_count}\n";
  print "Total C to T conversions in CHG context:\t$counting{total_unmethylated_CHG_count}\n";
  print "Total C to T conversions in CHH context:\t$counting{total_unmethylated_CHH_count}\n\n";

  ### printing methylated CpG percentage if applicable
  if ($percent_meCpG){
    print "C methylated in CpG context:\t${percent_meCpG}%\n";
  }
  else{
    print "Can't determine percentage of methylated Cs in CpG context if value was 0\n";
  }

  ### 2-Context Output
  if ($merge_non_CpG){
    if ($percent_non_CpG_methylation){
      print "C methylated in non-CpG context:\t${percent_non_CpG_methylation}%\n\n\n";
    }
    else{
      print "Can't determine percentage of methylated Cs in non-CpG context if value was 0\n\n\n";
    }
  }

  ### 3-Context Output
  else{
    ### printing methylated CHG percentage if applicable
    if ($percent_meCHG){
      print "C methylated in CHG context:\t${percent_meCHG}%\n";
    }
    else{
      print "Can't determine percentage of methylated Cs in CHG context if value was 0\n";
    }

    ### printing methylated CHH percentage if applicable
    if ($percent_meCHH){
      print "C methylated in CHH context:\t${percent_meCHH}%\n\n\n";
    }
    else{
      print "Can't determine percentage of methylated Cs in CHH context if value was 0\n\n\n";
    }
  }
}





sub print_individual_C_methylation_states_paired_end_files{

  my ($meth_call,$chrom,$start,$id,$strand,$filehandle_index,$no_overlap,$end_read_1,$cigar) = @_;
  my @methylation_calls = split(//,$meth_call);

  #################################################################
  ### . for bases not involving cytosines                       ###
  ### X for methylated C in CHG context (was protected)         ###
  ### x for not methylated C in CHG context (was converted)     ###
  ### H for methylated C in CHH context (was protected)         ###
  ### h for not methylated C in CHH context (was converted)     ###
  ### Z for methylated C in CpG context (was protected)         ###
  ### z for not methylated C in CpG context (was converted)     ###
  #################################################################

  my $methyl_CHG_count = 0;
  my $methyl_CHH_count = 0;
  my $methyl_CpG_count = 0;
  my $unmethylated_CHG_count = 0;
  my $unmethylated_CHH_count = 0;
  my $unmethylated_CpG_count = 0;

  my @len;
  my @ops;
  my $pos_offset = 0; # this is only relevant for SAM reads with insertions or deletions
  my $cigar_offset = 0; # again, this is only relevant for SAM reads containing indels
  my @comp_cigar;

  if ($cigar){ # parsing CIGAR string
    @len = split (/\D+/,$cigar); # storing the length per operation
    @ops = split (/\d+/,$cigar); # storing the operation
    shift @ops; # remove the empty first element
    die "CIGAR string contained a non-matching number of lengths and operations\n" unless (scalar @len == scalar @ops);

    foreach my $index (0..$#len){
      foreach (1..$len[$index]){
	# print  "$ops[$index]";
	push @comp_cigar, $ops[$index];
      }
    }
    # warn "\nDetected CIGAR string: $cigar\n";
    # warn "Length of methylation call: ",length $meth_call,"\n";
    # warn "number of operations: ",scalar @ops,"\n";
    # warn "number of length digits: ",scalar @len,"\n\n";
    # print @comp_cigar,"\n";
    # print "$meth_call\n\n";
    # sleep (1);
  }


  if ($strand eq '-') {

    ### the  CIGAR string needs to be reversed, the methylation call has already been reversed above
    @comp_cigar  = reverse@comp_cigar; # the CIGAR string needs to be reversed for all reads aligning to the reverse strand, too
    #  print "reverse CIGAR string: @comp_cigar\n";

    ### the start position of paired-end files has already been corrected, see above
  }

  ### THIS IS AN OPTIONAL 2-CONTEXT (CpG and non-CpG) SECTION IF --merge_non_CpG was specified

  if ($merge_non_CpG) {

    if ($no_overlap) {

      ### single-file CpG and non-CpG context output
      if ($full) {
	if ($strand eq '+') {
	  for my $index (0..$#methylation_calls) {
	
	    if ($cigar){ # only needed for SAM files
	      my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
	      # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition+index: ",$start+$index,"\t";
	      $cigar_offset += $cigar_mod;
	      $pos_offset += $pos_mod;
	    }
	
	    ### Returning as soon as the methylation calls start overlapping
	    if ($start+$index+$pos_offset >= $end_read_1) {
	      return;
	    }

	    if ($methylation_calls[$index] eq 'X') {
	      $counting{total_meCHG_count}++;
	      print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	    } elsif ($methylation_calls[$index] eq 'x') {
	      $counting{total_unmethylated_CHG_count}++;
	      print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	    } elsif ($methylation_calls[$index] eq 'Z') {
	      $counting{total_meCpG_count}++;
	      print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	    } elsif ($methylation_calls[$index] eq 'z') {
	      $counting{total_unmethylated_CpG_count}++;
	      print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	    } elsif ($methylation_calls[$index] eq 'H') {
	      $counting{total_meCHH_count}++;
	      print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	    } elsif ($methylation_calls[$index] eq 'h') {
	      $counting{total_unmethylated_CHH_count}++;
	      print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	    }
	    elsif ($methylation_calls[$index] eq '.'){}
	    else{
	      die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n";
	    }
	  }
	} elsif ($strand eq '-') {
	  for my $index (0..$#methylation_calls) {
	
	    if ($cigar){ # only needed for SAM files
	      # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition-index: ",$start-$index,"\t";
	      my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
	      $cigar_offset += $cigar_mod;
	      $pos_offset += $pos_mod;
	    }
	
	    ### Returning as soon as the methylation calls start overlapping
	    if ($start-$index+$pos_offset <= $end_read_1) {
	      return;
	    }

	    if ($methylation_calls[$index] eq 'X') {
	      $counting{total_meCHG_count}++;
	      print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	    } elsif ($methylation_calls[$index] eq 'x') {
	      $counting{total_unmethylated_CHG_count}++;
	      print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	    } elsif ($methylation_calls[$index] eq 'Z') {
	      $counting{total_meCpG_count}++;
	      print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	    } elsif ($methylation_calls[$index] eq 'z') {
	      $counting{total_unmethylated_CpG_count}++;
	      print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	    } elsif ($methylation_calls[$index] eq 'H') {
	      $counting{total_meCHH_count}++;
	      print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	    } elsif ($methylation_calls[$index] eq 'h') {
	      $counting{total_unmethylated_CHH_count}++;
	      print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	    }
	    elsif ($methylation_calls[$index] eq '.') {}
	    else{
	      die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n";
	    }
	  }
	} else {
	  die "The read orientation was neither + nor -: '$strand'\n";
	}
      }

      ### strand-specific methylation output
      else {
	if ($strand eq '+') {
	  for my $index (0..$#methylation_calls) {

	    if ($cigar){ # only needed for SAM files
	      my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
	      # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition+index: ",$start+$index,"\t";
	      $cigar_offset += $cigar_mod;
	      $pos_offset += $pos_mod;
	    }

	    ### Returning as soon as the methylation calls start overlapping
	    if ($start+$index+$pos_offset >= $end_read_1) {
	      return;
	    }

	    if ($methylation_calls[$index] eq 'X') {
	      $counting{total_meCHG_count}++;
	      print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	    } elsif ($methylation_calls[$index] eq 'x') {
	      $counting{total_unmethylated_CHG_count}++;
	      print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	    } elsif ($methylation_calls[$index] eq 'Z') {
	      $counting{total_meCpG_count}++;
	      print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	    } elsif ($methylation_calls[$index] eq 'z') {
	      $counting{total_unmethylated_CpG_count}++;
	      print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	    } elsif ($methylation_calls[$index] eq 'H') {
	      $counting{total_meCHH_count}++;
	      print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	    } elsif ($methylation_calls[$index] eq 'h') {
	      $counting{total_unmethylated_CHH_count}++;
	      print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	    }
	    elsif ($methylation_calls[$index] eq '.') {}
	    else{
	      die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n";
	    }	
	  }
	} elsif ($strand eq '-') {
	  for my $index (0..$#methylation_calls) {

	    if ($cigar){ # only needed for SAM files
	      # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition-index: ",$start-$index,"\t";
	      my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
	      $cigar_offset += $cigar_mod;
	      $pos_offset += $pos_mod;
	    }

	    ### Returning as soon as the methylation calls start overlapping
	    if ($start-$index+$pos_offset <= $end_read_1) {
	      return;
	    }

	    if ($methylation_calls[$index] eq 'X') {
	      $counting{total_meCHG_count}++;
	      print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	    } elsif ($methylation_calls[$index] eq 'x') {
	      $counting{total_unmethylated_CHG_count}++;
	      print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	    } elsif ($methylation_calls[$index] eq 'Z') {
	      $counting{total_meCpG_count}++;
	      print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	    } elsif ($methylation_calls[$index] eq 'z') {
	      $counting{total_unmethylated_CpG_count}++;
	      print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	    } elsif ($methylation_calls[$index] eq 'H') {
	      $counting{total_meCHH_count}++;
	      print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	    } elsif ($methylation_calls[$index] eq 'h') {
	      $counting{total_unmethylated_CHH_count}++;
	      print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	    }
	    elsif ($methylation_calls[$index] eq '.') {}
	    else{
	      die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n";
	    }
	  }
	} else {
	  die "The strand orientation was neither + nor -: '$strand'/n";
	}
      }
    }

    ### this is the default paired-end procedure allowing overlaps and using every single C position
    ### Still within the 2-CONTEXT ONLY optional section
    else {
      ### single-file CpG and non-CpG context output
      if ($full) {
	if ($strand eq '+') {
	  for my $index (0..$#methylation_calls) {

	    if ($cigar){ # only needed for SAM files
	      my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
	      # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition+index: ",$start+$index,"\t";
	      $cigar_offset += $cigar_mod;
	      $pos_offset += $pos_mod;
	    }

	    if ($methylation_calls[$index] eq 'X') {
	      $counting{total_meCHG_count}++;
	      print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	    } elsif ($methylation_calls[$index] eq 'x') {
	      $counting{total_unmethylated_CHG_count}++;
	      print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	    } elsif ($methylation_calls[$index] eq 'Z') {
	      $counting{total_meCpG_count}++;
	      print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	    } elsif ($methylation_calls[$index] eq 'z') {
	      $counting{total_unmethylated_CpG_count}++;
	      print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	    } elsif ($methylation_calls[$index] eq 'H') {
	      $counting{total_meCHH_count}++;
	      print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	    } elsif ($methylation_calls[$index] eq 'h') {
	      $counting{total_unmethylated_CHH_count}++;
	      print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	    }
	    elsif ($methylation_calls[$index] eq '.') {}
	    else{
	      die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n";
	    }
	  }
	} elsif ($strand eq '-') {
	  for my $index (0..$#methylation_calls) {

	    if ($cigar){ # only needed for SAM files
	      # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition-index: ",$start-$index,"\t";
	      my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
	      $cigar_offset += $cigar_mod;
	      $pos_offset += $pos_mod;
	    }

	    if ($methylation_calls[$index] eq 'X') {
	      $counting{total_meCHG_count}++;
	      print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	    } elsif ($methylation_calls[$index] eq 'x') {
	      $counting{total_unmethylated_CHG_count}++;
	      print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	    } elsif ($methylation_calls[$index] eq 'Z') {
	      $counting{total_meCpG_count}++;
	      print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	    } elsif ($methylation_calls[$index] eq 'z') {
	      $counting{total_unmethylated_CpG_count}++;
	      print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	    } elsif ($methylation_calls[$index] eq 'H') {
	      $counting{total_meCHH_count}++;
	      print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	    } elsif ($methylation_calls[$index] eq 'h') {
	      $counting{total_unmethylated_CHH_count}++;
	      print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	    }
	    elsif ($methylation_calls[$index] eq '.') {}
	    else{
	      die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n";
	    }
	  }
	} else {
	  die "The strand orientation as neither + nor -: '$strand'\n";
	}
      }

      ### strand-specific methylation output
      ### still within the 2-CONTEXT optional section
      else {
	if ($strand eq '+') {
	  for my $index (0..$#methylation_calls) {

	    if ($cigar){ # only needed for SAM files
	      my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
	      # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition+index: ",$start+$index,"\t";
	      $cigar_offset += $cigar_mod;
	      $pos_offset += $pos_mod;
	    }

	    if ($methylation_calls[$index] eq 'X') {
	      $counting{total_meCHG_count}++;
	      print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	    } elsif ($methylation_calls[$index] eq 'x') {
	      $counting{total_unmethylated_CHG_count}++;
	      print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	    } elsif ($methylation_calls[$index] eq 'Z') {
	      $counting{total_meCpG_count}++;
	      print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	    } elsif ($methylation_calls[$index] eq 'z') {
	      $counting{total_unmethylated_CpG_count}++;
	      print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	    } elsif ($methylation_calls[$index] eq 'H') {
	      $counting{total_meCHH_count}++;
	      print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	    } elsif ($methylation_calls[$index] eq 'h') {
	      $counting{total_unmethylated_CHH_count}++;
	      print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	    }
	    elsif ($methylation_calls[$index] eq '.') {}
	    else{
	      die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n";
	    }
	  }
	} elsif ($strand eq '-') {
	  for my $index (0..$#methylation_calls) {

	    if ($cigar){ # only needed for SAM files
	      # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition-index: ",$start-$index,"\t";
	      my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
	      $cigar_offset += $cigar_mod;
	      $pos_offset += $pos_mod;
	    }

	    if ($methylation_calls[$index] eq 'X') {
	      $counting{total_meCHG_count}++;
	      print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	    } elsif ($methylation_calls[$index] eq 'x') {
	      $counting{total_unmethylated_CHG_count}++;
	      print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	    } elsif ($methylation_calls[$index] eq 'Z') {
	      $counting{total_meCpG_count}++;
	      print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	    } elsif ($methylation_calls[$index] eq 'z') {
	      $counting{total_unmethylated_CpG_count}++;
	      print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	    } elsif ($methylation_calls[$index] eq 'H') {
	      $counting{total_meCHH_count}++;
	      print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	    } elsif ($methylation_calls[$index] eq 'h') {
	      $counting{total_unmethylated_CHH_count}++;
	      print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	    }
	    elsif ($methylation_calls[$index] eq '.') {}
	    else{
	      die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n";
	    }
	  }
	} else {
	  die "The strand orientation as neither + nor -: '$strand'\n";
	}
      }
    }
  }

  ############################################
  ### THIS IS THE DEFAULT 3-CONTEXT OUTPUT ###
  ############################################

  elsif ($no_overlap) {
    ### single-file CpG, CHG and CHH context output
    if ($full) {
      if ($strand eq '+') {
	for my $index (0..$#methylation_calls) {
	
	  if ($cigar){ # only needed for SAM files
	    my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
	    # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition+index: ",$start+$index,"\t";
	    $cigar_offset += $cigar_mod;
	    $pos_offset += $pos_mod;
	  }

	  ### Returning as soon as the methylation calls start overlapping
	  if ($start+$index+$pos_offset >= $end_read_1) {
	    return;
	  }
	
	  if ($methylation_calls[$index] eq 'X') {
	    $counting{total_meCHG_count}++;
	    print {$fhs{CHG_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	  } elsif ($methylation_calls[$index] eq 'x') {
	    $counting{total_unmethylated_CHG_count}++;
	    print {$fhs{CHG_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	  } elsif ($methylation_calls[$index] eq 'Z') {
	    $counting{total_meCpG_count}++;
	    print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	  } elsif ($methylation_calls[$index] eq 'z') {
	    $counting{total_unmethylated_CpG_count}++;
	    print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	  } elsif ($methylation_calls[$index] eq 'H') {
	    $counting{total_meCHH_count}++;
	    print {$fhs{CHH_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	  } elsif ($methylation_calls[$index] eq 'h') {
	    $counting{total_unmethylated_CHH_count}++;
	    print {$fhs{CHH_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	  }
	  elsif ($methylation_calls[$index] eq '.') {}
	  else{
	    die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n";
	  }
	}
      } elsif ($strand eq '-') {
	for my $index (0..$#methylation_calls) {

	  if ($cigar){ # only needed for SAM files
	    # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition-index: ",$start-$index,"\t";
	    my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
	    $cigar_offset += $cigar_mod;
	    $pos_offset += $pos_mod;
	  }

	  ### Returning as soon as the methylation calls start overlapping
	  if ($start-$index+$pos_offset <= $end_read_1) {
	    return;
	  }
	
	  if ($methylation_calls[$index] eq 'X') {
	    $counting{total_meCHG_count}++;
	    print {$fhs{CHG_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	  } elsif ($methylation_calls[$index] eq 'x') {
	    $counting{total_unmethylated_CHG_count}++;
	    print {$fhs{CHG_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	  } elsif ($methylation_calls[$index] eq 'Z') {
	    $counting{total_meCpG_count}++;
	    print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	  } elsif ($methylation_calls[$index] eq 'z') {
	    $counting{total_unmethylated_CpG_count}++;
	    print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	  } elsif ($methylation_calls[$index] eq 'H') {
	    $counting{total_meCHH_count}++;
	    print {$fhs{CHH_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	  } elsif ($methylation_calls[$index] eq 'h') {
	    $counting{total_unmethylated_CHH_count}++;
	    print {$fhs{CHH_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	  }
	  elsif ($methylation_calls[$index] eq '.') {}
	  else{
	    die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n";
	  }
	}
      } else {
	die "The strand orientation as neither + nor -: '$strand'\n";
      }
    }

    ### strand-specific methylation output
    else {
      if ($strand eq '+') {
	for my $index (0..$#methylation_calls) {

	  if ($cigar){ # only needed for SAM files
	    my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
	    # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition+index: ",$start+$index,"\t";
	    $cigar_offset += $cigar_mod;
	    $pos_offset += $pos_mod;
	  }

	  ### Returning as soon as the methylation calls start overlapping
	  if ($start+$index+$pos_offset >= $end_read_1) {
	    return;
	  }
	
	  if ($methylation_calls[$index] eq 'X') {
	    $counting{total_meCHG_count}++;
	    print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	  } elsif ($methylation_calls[$index] eq 'x') {
	    $counting{total_unmethylated_CHG_count}++;
	    print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	  } elsif ($methylation_calls[$index] eq 'Z') {
	    $counting{total_meCpG_count}++;
	    print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	  } elsif ($methylation_calls[$index] eq 'z') {
	    $counting{total_unmethylated_CpG_count}++;
	    print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	  } elsif ($methylation_calls[$index] eq 'H') {
	    $counting{total_meCHH_count}++;
	    print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	  } elsif ($methylation_calls[$index] eq 'h') {
	    $counting{total_unmethylated_CHH_count}++;
	    print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	  }
	  elsif ($methylation_calls[$index] eq '.') {}
	  else{
	    die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n";
	  }	
	}
      } elsif ($strand eq '-') {
	for my $index (0..$#methylation_calls) {

	  if ($cigar){ # only needed for SAM files
	    # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition-index: ",$start-$index,"\t";
	    my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
	    $cigar_offset += $cigar_mod;
	    $pos_offset += $pos_mod;
	  }

	  ### Returning as soon as the methylation calls start overlapping
	  if ($start-$index+$pos_offset <= $end_read_1) {
	    return;
	  }
	
	  if ($methylation_calls[$index] eq 'X') {
	    $counting{total_meCHG_count}++;
	    print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	  } elsif ($methylation_calls[$index] eq 'x') {
	    $counting{total_unmethylated_CHG_count}++;
	    print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	  } elsif ($methylation_calls[$index] eq 'Z') {
	    $counting{total_meCpG_count}++;
	    print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	  } elsif ($methylation_calls[$index] eq 'z') {
	    $counting{total_unmethylated_CpG_count}++;
	    print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	  } elsif ($methylation_calls[$index] eq 'H') {
	    $counting{total_meCHH_count}++;
	    print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	  } elsif ($methylation_calls[$index] eq 'h') {
	    $counting{total_unmethylated_CHH_count}++;
	    print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	  }
	  elsif ($methylation_calls[$index] eq '.') {}
	  else{
	    die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n";
	  }
	}
      } else {
	die "The strand orientation as neither + nor -: '$strand'\n";
      }
    }
  }

  ### this is the default paired-end procedure allowing overlaps and using every single C position
  else {
    ### single-file CpG, CHG and CHH context output
    if ($full) {
      if ($strand eq '+') {
	for my $index (0..$#methylation_calls) {

	  if ($cigar){ # only needed for SAM files
	    my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
	    # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition+index: ",$start+$index,"\t";
	    $cigar_offset += $cigar_mod;
	    $pos_offset += $pos_mod;
	  }

	  if ($methylation_calls[$index] eq 'X') {
	    $counting{total_meCHG_count}++;
	    print {$fhs{CHG_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	  } elsif ($methylation_calls[$index] eq 'x') {
	    $counting{total_unmethylated_CHG_count}++;
	    print {$fhs{CHG_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	  } elsif ($methylation_calls[$index] eq 'Z') {
	    $counting{total_meCpG_count}++;
	    print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	  } elsif ($methylation_calls[$index] eq 'z') {
	    $counting{total_unmethylated_CpG_count}++;
	    print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	  } elsif ($methylation_calls[$index] eq 'H') {
	    $counting{total_meCHH_count}++;
	    print {$fhs{CHH_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	  } elsif ($methylation_calls[$index] eq 'h') {
	    $counting{total_unmethylated_CHH_count}++;
	    print {$fhs{CHH_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	  }
	  elsif ($methylation_calls[$index] eq '.') {}
	  else{
	    die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n";
	  }
	}
      } elsif ($strand eq '-') {
	for my $index (0..$#methylation_calls) {

	  if ($cigar){ # only needed for SAM files
	    # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition-index: ",$start-$index,"\t";
	    my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
	    $cigar_offset += $cigar_mod;
	    $pos_offset += $pos_mod;
	  }

	  if ($methylation_calls[$index] eq 'X') {
	    $counting{total_meCHG_count}++;
	    print {$fhs{CHG_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	  } elsif ($methylation_calls[$index] eq 'x') {
	    $counting{total_unmethylated_CHG_count}++;
	    print {$fhs{CHG_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	  } elsif ($methylation_calls[$index] eq 'Z') {
	    $counting{total_meCpG_count}++;
	    print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	  } elsif ($methylation_calls[$index] eq 'z') {
	    $counting{total_unmethylated_CpG_count}++;
	    print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	  } elsif ($methylation_calls[$index] eq 'H') {
	    $counting{total_meCHH_count}++;
	    print {$fhs{CHH_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	  } elsif ($methylation_calls[$index] eq 'h') {
	    $counting{total_unmethylated_CHH_count}++;
	    print {$fhs{CHH_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	  }
	  elsif ($methylation_calls[$index] eq '.') {}
	  else{
	    die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n";
	  }
	}
      } else {
	die "The strand orientation as neither + nor -: '$strand'\n";
      }
    }

    ### strand-specific methylation output
    else {
      if ($strand eq '+') {
	for my $index (0..$#methylation_calls) {

	  if ($cigar){ # only needed for SAM files
	    my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
	    # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition+index: ",$start+$index,"\t";
	    $cigar_offset += $cigar_mod;
	    $pos_offset += $pos_mod;
	  }

	  if ($methylation_calls[$index] eq 'X') {
	    $counting{total_meCHG_count}++;
	    print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	  } elsif ($methylation_calls[$index] eq 'x') {
	    $counting{total_unmethylated_CHG_count}++;
	    print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	  } elsif ($methylation_calls[$index] eq 'Z') {
	    $counting{total_meCpG_count}++;
	    print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	  } elsif ($methylation_calls[$index] eq 'z') {
	    $counting{total_unmethylated_CpG_count}++;
	    print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	  } elsif ($methylation_calls[$index] eq 'H') {
	    $counting{total_meCHH_count}++;
	    print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	  } elsif ($methylation_calls[$index] eq 'h') {
	    $counting{total_unmethylated_CHH_count}++;
	    print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	  }
	  elsif ($methylation_calls[$index] eq '.') {}
	  else{
	    die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n";
	  }
	}
      } elsif ($strand eq '-') {
	for my $index (0..$#methylation_calls) {

	  if ($cigar){ # only needed for SAM files
	    # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition-index: ",$start-$index,"\t";
	    my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
	    $cigar_offset += $cigar_mod;
	    $pos_offset += $pos_mod;
	  }

	  if ($methylation_calls[$index] eq 'X') {
	    $counting{total_meCHG_count}++;
	    print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	  } elsif ($methylation_calls[$index] eq 'x') {
	    $counting{total_unmethylated_CHG_count}++;
	    print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	  } elsif ($methylation_calls[$index] eq 'Z') {
	    $counting{total_meCpG_count}++;
	    print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	  } elsif ($methylation_calls[$index] eq 'z') {
	    $counting{total_unmethylated_CpG_count}++;
	    print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	  } elsif ($methylation_calls[$index] eq 'H') {
	    $counting{total_meCHH_count}++;
	    print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	  } elsif ($methylation_calls[$index] eq 'h') {
	    $counting{total_unmethylated_CHH_count}++;
	    print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	  }
	  elsif ($methylation_calls[$index] eq '.') {}
	  else{
	    die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n";
	  }
	}
      } else {
	die "The strand orientation as neither + nor -: '$strand'\n";
      }
    }
  }
}

sub check_cigar_string {
  my ($index,$cigar_offset,$pos_offset,$strand,$comp_cigar) = @_;
  # print "$index\t$cigar_offset\t$pos_offset\t$strand\t";
  my ($new_cigar_offset,$new_pos_offset) = (0,0);

  if ($strand eq '+') {
    #  print "### $strand strand @$comp_cigar[$index + $cigar_offset]\t";

    if (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'M'){ # sequence position matches the genomic position
      #  warn "position needs no adjustment\n";
    }

    elsif (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'I'){ # insertion in the read sequence
      $new_pos_offset -= 1; # we need to subtract the length of inserted bases from the genomic position
      # warn "adjusted genomic position by -1 bp (insertion)\n";
    }

    elsif (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'D'){ # deletion in the read sequence
      $new_cigar_offset += 1; # the composite cigar string does no longer match the methylation call index
      $new_pos_offset += 1; # we need to add the length of deleted bases to get the genomic position
      # warn "adjusted genomic position by +1 bp (deletion). Now looping through the CIGAR string until we hit another M or I\n";

      while ( ($index + $cigar_offset + $new_cigar_offset)  < (scalar @$comp_cigar) ){	
	if (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'M'){ # sequence position matches the genomic position
	  #  warn "position needs no adjustment\n";
	  last;
	}
	elsif (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'I'){
	  $new_pos_offset -= 1; # we need to subtract the length of inserted bases from the genomic position
	  # warn "adjusted genomic position by another -1 bp (insertion)\n";
	  last;
	}
	elsif (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'D'){ # deletion in the read sequence
	  $new_cigar_offset += 1; # the composite cigar string does no longer match the methylation call index
	  $new_pos_offset += 1; # we need to add the length of deleted bases to get the genomic position
	  # warn "adjusted genomic position by another +1 bp (deletion)\n";
	}
	else{
	  die "The CIGAR string contained undefined operations in addition to 'M', 'I' and 'D': '@$comp_cigar[$index + $cigar_offset + $new_cigar_offset]'\n";
	}
      }
    }
    else{
      die "The CIGAR string contained undefined operations in addition to 'M', 'I' and 'D': '@$comp_cigar[$index + $cigar_offset + $new_cigar_offset]'\n";
    }
  }

  elsif ($strand eq '-') {
    # print "### $strand strand @$comp_cigar[$index + $cigar_offset]\t";

    if (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'M'){ # sequence position matches the genomic position
     # warn "position needs no adjustment\n";
    }

    elsif (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'I'){ # insertion in the read sequence
      $new_pos_offset += 1; # we need to add the length of inserted bases to the genomic position
      # warn "adjusted genomic position by +1 bp (insertion)\n";
    }

    elsif (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'D'){ # deletion in the read sequence
      $new_cigar_offset += 1; # the composite cigar string does no longer match the methylation call index
      $new_pos_offset -= 1; # we need to subtract the length of deleted bases to get the genomic position
      # warn "adjusted genomic position by -1 bp (deletion). Now looping through the CIGAR string until we hit another M or I\n";

      while ( ($index + $cigar_offset + $new_cigar_offset)  < (scalar @$comp_cigar) ){	
	if (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'M'){ # sequence position matches the genomic position
	  # warn "Found new 'M' operation; position needs no adjustment\n";
	  last;
	}
	elsif (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'I'){
	  $new_pos_offset += 1; # we need to subtract the length of inserted bases from the genomic position
	  # warn "Found new 'I' operation; adjusted genomic position by another +1 bp (insertion)\n";
	  last;
	}
	elsif (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'D'){ # deletion in the read sequence
	  $new_cigar_offset += 1; # the composite cigar string does no longer match the methylation call index
	  $new_pos_offset -= 1; # we need to subtract the length of deleted bases to get the genomic position
	  # warn "adjusted genomic position by another -1 bp (deletion)\n";
	}
	else{
	  die "The CIGAR string contained undefined operations in addition to 'M', 'I' and 'D': '@$comp_cigar[$index + $cigar_offset + $new_cigar_offset]'\n";
	}
      }
    }
    else{
      die "The CIGAR string contained undefined operations in addition to 'M', 'I' and 'D': '@$comp_cigar[$index + $cigar_offset + $new_cigar_offset]'\n";
    }
  }
  # print "new cigar offset: $new_cigar_offset\tnew pos offset: $new_pos_offset\n";
  return ($new_cigar_offset,$new_pos_offset);
}

sub print_individual_C_methylation_states_single_end{

  my ($meth_call,$chrom,$start,$id,$strand,$filehandle_index,$cigar) = @_;
  my @methylation_calls = split(//,$meth_call);

  #################################################################
  ### . for bases not involving cytosines                       ###
  ### X for methylated C in CHG context (was protected)         ###
  ### x for not methylated C in CHG context (was converted)     ###
  ### H for methylated C in CHH context (was protected)         ###
  ### h for not methylated C in CHH context (was converted)     ###
  ### Z for methylated C in CpG context (was protected)         ###
  ### z for not methylated C in CpG context (was converted)     ###
  #################################################################

  my $methyl_CHG_count = 0;
  my $methyl_CHH_count = 0;
  my $methyl_CpG_count = 0;
  my $unmethylated_CHG_count = 0;
  my $unmethylated_CHH_count = 0;
  my $unmethylated_CpG_count = 0;

  my @len;
  my @ops;
  my $pos_offset = 0; # this is only relevant for SAM reads with insertions or deletions
  my $cigar_offset = 0; # again, this is only relevant for SAM reads containing indels

  my @comp_cigar;

  if ($cigar){ # parsing CIGAR string
    @len = split (/\D+/,$cigar); # storing the length per operation
    @ops = split (/\d+/,$cigar); # storing the operation
    shift @ops; # remove the empty first element
    die "CIGAR string contained a non-matching number of lengths and operations\n" unless (scalar @len == scalar @ops);

    foreach my $index (0..$#len){
      foreach (1..$len[$index]){
	# print  "$ops[$index]";
	push @comp_cigar, $ops[$index];
      }
    }
    # warn "\nDetected CIGAR string: $cigar\n";
    # warn "Length of methylation call: ",length $meth_call,"\n";
    # warn "number of operations: ",scalar @ops,"\n";
    # warn "number of length digits: ",scalar @len,"\n\n";
    # print @comp_cigar,"\n";
    # print "$meth_call\n\n";
    # sleep (1);
  }

  ### adjusting the start position for all reads mapping to the reverse strand
  if ($strand eq '-') {

    @comp_cigar  = reverse@comp_cigar; # the CIGAR string needs to be reversed for all reads aligning to the reverse strand, too
    # print @comp_cigar,"\n";

    unless ($ignore){  ### if --ignore was specified the start position has already been corrected

      if ($cigar){ ### SAM format
	my $MD_count = 0;
	foreach (@comp_cigar){
	  ++$MD_count if ($_ eq 'M' or $_ eq 'D'); # Matching bases or deletions affect the genomic position of the 3' ends of reads, insertions don't
	}
	$start += $MD_count - 1;
      }
      else{ ### vanilla format
	$start += length($meth_call)-1;
      }
    }
  }

  ### THIS IS THE CpG and Non-CpG SECTION (OPTIONAL)

  ### single-file CpG and other-context output
  if ($full and $merge_non_CpG) {
    if ($strand eq '+') {
      for my $index (0..$#methylation_calls) {

	if ($cigar){ # only needed for SAM files
	  my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
	  # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition+index: ",$start+$index,"\t";
	  $cigar_offset += $cigar_mod;
	  $pos_offset += $pos_mod;
	}

	### methylated Cs (any context) will receive a forward (+) orientation
	### not methylated Cs (any context) will receive a reverse (-) orientation
	if ($methylation_calls[$index] eq 'X') {
	  $counting{total_meCHG_count}++;
	  print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	}
	elsif ($methylation_calls[$index] eq 'x') {
	  $counting{total_unmethylated_CHG_count}++;
	  print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	}
	elsif ($methylation_calls[$index] eq 'Z') {
	  $counting{total_meCpG_count}++;
	  print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	}
	elsif ($methylation_calls[$index] eq 'z') {
	  $counting{total_unmethylated_CpG_count}++;
	  print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	}
	elsif ($methylation_calls[$index] eq 'H') {
	  $counting{total_meCHH_count}++;
	  print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	}
	elsif ($methylation_calls[$index] eq 'h') {
	  $counting{total_unmethylated_CHH_count}++;
	  print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	}
	elsif ($methylation_calls[$index] eq '.') {
	}
	else{
	  die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n";
	}
      }
    }
    elsif ($strand eq '-') {

      for my $index (0..$#methylation_calls) {
	### methylated Cs (any context) will receive a forward (+) orientation
	### not methylated Cs (any context) will receive a reverse (-) orientation

	if ($cigar){ # only needed for SAM files
	  # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition-index: ",$start-$index,"\t";
	  my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
	  $cigar_offset += $cigar_mod;
	  $pos_offset += $pos_mod;
	}

	if ($methylation_calls[$index] eq 'X') {
	  $counting{total_meCHG_count}++;
	  print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	}
	elsif ($methylation_calls[$index] eq 'x') {
	  $counting{total_unmethylated_CHG_count}++;
	  print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	}
	elsif ($methylation_calls[$index] eq 'Z') {
	  $counting{total_meCpG_count}++;
	  print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	}
	elsif ($methylation_calls[$index] eq 'z') {
	  $counting{total_unmethylated_CpG_count}++;
	  print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	}
	elsif ($methylation_calls[$index] eq 'H') {
	  $counting{total_meCHH_count}++;
	  print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	}
	elsif ($methylation_calls[$index] eq 'h') {
	  $counting{total_unmethylated_CHH_count}++;
	  print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	}
	elsif ($methylation_calls[$index] eq '.'){
	}
	else{
	  die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n";
	}
      }
    }
    else {
      die "The strand information was neither + nor -: $strand\n";
    }
  }

  ### strand-specific methylation output
  elsif ($merge_non_CpG) {
    if ($strand eq '+') {
      for my $index (0..$#methylation_calls) {
	### methylated Cs (any context) will receive a forward (+) orientation
	### not methylated Cs (any context) will receive a reverse (-) orientation

	if ($cigar){ # only needed for SAM files
	  my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
	  $cigar_offset += $cigar_mod;
	  $pos_offset += $pos_mod;
	}

	if ($methylation_calls[$index] eq 'X') {
	  $counting{total_meCHG_count}++;
	  print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	}
	elsif ($methylation_calls[$index] eq 'x') {
	  $counting{total_unmethylated_CHG_count}++;
	  print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	}
	elsif ($methylation_calls[$index] eq 'Z') {
	  $counting{total_meCpG_count}++;
	  print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	}
	elsif ($methylation_calls[$index] eq 'z') {
	  $counting{total_unmethylated_CpG_count}++;
	  print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	}
	elsif ($methylation_calls[$index] eq 'H') {
	  $counting{total_meCHH_count}++;
	  print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	}
	elsif ($methylation_calls[$index] eq 'h') {
	  $counting{total_unmethylated_CHH_count}++;
	  print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	}
	elsif ($methylation_calls[$index] eq '.') {
	}
	else{
	  die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n";
	}
      }
    }
    elsif ($strand eq '-') {

      for my $index (0..$#methylation_calls) {
	### methylated Cs (any context) will receive a forward (+) orientation
	### not methylated Cs (any context) will receive a reverse (-) orientation

    	if ($cigar){ # only needed for SAM files
	  my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
	  $cigar_offset += $cigar_mod;
	  $pos_offset += $pos_mod;
	}

	if ($methylation_calls[$index] eq 'X') {
	  $counting{total_meCHG_count}++;
	  print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	}
	elsif ($methylation_calls[$index] eq 'x') {
	  $counting{total_unmethylated_CHG_count}++;
	  print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	}
	elsif ($methylation_calls[$index] eq 'Z') {
	  $counting{total_meCpG_count}++;
	  print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	}
	elsif ($methylation_calls[$index] eq 'z') {
	  $counting{total_unmethylated_CpG_count}++;
	  print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	}
	elsif ($methylation_calls[$index] eq 'H') {
	  $counting{total_meCHH_count}++;
	  print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	}
	elsif ($methylation_calls[$index] eq 'h') {
	  $counting{total_unmethylated_CHH_count}++;
	  print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	}
	elsif ($methylation_calls[$index] eq '.') {
	}
	else{
	  die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n";
	}
      }
    }
    else {
      die "The strand information was neither + nor -: $strand\n";
    }
  }

  ### THIS IS THE 3-CONTEXT (CpG, CHG and CHH) DEFAULT SECTION

  elsif ($full) {
    if ($strand eq '+') {
      for my $index (0..$#methylation_calls) {
	### methylated Cs (any context) will receive a forward (+) orientation
	### not methylated Cs (any context) will receive a reverse (-) orientation

	if ($cigar){ # only needed for SAM files
	  my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
	  $cigar_offset += $cigar_mod;
	  $pos_offset += $pos_mod;
	}

	if ($methylation_calls[$index] eq 'X') {
	  $counting{total_meCHG_count}++;
	  print {$fhs{CHG_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	} elsif ($methylation_calls[$index] eq 'x') {
	  $counting{total_unmethylated_CHG_count}++;
	  print {$fhs{CHG_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	} elsif ($methylation_calls[$index] eq 'Z') {
	  $counting{total_meCpG_count}++;
	  print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	} elsif ($methylation_calls[$index] eq 'z') {
	  $counting{total_unmethylated_CpG_count}++;
	  print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	} elsif ($methylation_calls[$index] eq 'H') {
	  $counting{total_meCHH_count}++;
	  print {$fhs{CHH_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	} elsif ($methylation_calls[$index] eq 'h') {
	  $counting{total_unmethylated_CHH_count}++;
	  print {$fhs{CHH_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	}
	elsif ($methylation_calls[$index] eq '.') {}
	else{
	  die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n";
	}
      }
    }
    elsif ($strand eq '-') {

      for my $index (0..$#methylation_calls) {
	### methylated Cs (any context) will receive a forward (+) orientation
	### not methylated Cs (any context) will receive a reverse (-) orientation

	if ($cigar){ # only needed for SAM files
	  my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
	  $cigar_offset += $cigar_mod;
	  $pos_offset += $pos_mod;
	}
	
	if ($methylation_calls[$index] eq 'X') {
	  $counting{total_meCHG_count}++;
	  print {$fhs{CHG_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	} elsif ($methylation_calls[$index] eq 'x') {
	  $counting{total_unmethylated_CHG_count}++;
	  print {$fhs{CHG_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	} elsif ($methylation_calls[$index] eq 'Z') {
	  $counting{total_meCpG_count}++;
	  print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	} elsif ($methylation_calls[$index] eq 'z') {
	  $counting{total_unmethylated_CpG_count}++;
	  print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	} elsif ($methylation_calls[$index] eq 'H') {
	  $counting{total_meCHH_count}++;
	  print {$fhs{CHH_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	} elsif ($methylation_calls[$index] eq 'h') {
	  $counting{total_unmethylated_CHH_count}++;
	  print {$fhs{CHH_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	}
	elsif ($methylation_calls[$index] eq '.') {}
	else{
	  die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n";
	}
      }
    }
    else {
      die "The read had a strand orientation which was neither + nor -: $strand\n";
    }
  }

  ### strand-specific methylation output
  else {
    if ($strand eq '+') {
      for my $index (0..$#methylation_calls) {
	### methylated Cs (any context) will receive a forward (+) orientation
	### not methylated Cs (any context) will receive a reverse (-) orientation

	if ($cigar){ # only needed for SAM files
	  my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
	  $cigar_offset += $cigar_mod;
	  $pos_offset += $pos_mod;
	}

	if ($methylation_calls[$index] eq 'X') {
	  $counting{total_meCHG_count}++;
	  print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	} elsif ($methylation_calls[$index] eq 'x') {
	  $counting{total_unmethylated_CHG_count}++;
	  print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	} elsif ($methylation_calls[$index] eq 'Z') {
	  $counting{total_meCpG_count}++;
	  print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	} elsif ($methylation_calls[$index] eq 'z') {
	  $counting{total_unmethylated_CpG_count}++;
	  print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	} elsif ($methylation_calls[$index] eq 'H') {
	  $counting{total_meCHH_count}++;
	  print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	} elsif ($methylation_calls[$index] eq 'h') {
	  $counting{total_unmethylated_CHH_count}++;
	  print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index]),"\n";
	}
	elsif ($methylation_calls[$index] eq '.') {}
	else{
	  die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n";
	}
      }
    }
    elsif ($strand eq '-') {

      for my $index (0..$#methylation_calls) {
	### methylated Cs (any context) will receive a forward (+) orientation
	### not methylated Cs (any context) will receive a reverse (-) orientation

	if ($cigar){ # only needed for SAM files
	  my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
	  $cigar_offset += $cigar_mod;
	  $pos_offset += $pos_mod;
	}

	if ($methylation_calls[$index] eq 'X') {
	  $counting{total_meCHG_count}++;
	  print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	} elsif ($methylation_calls[$index] eq 'x') {
	  $counting{total_unmethylated_CHG_count}++;
	  print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	} elsif ($methylation_calls[$index] eq 'Z') {
	  $counting{total_meCpG_count}++;
	  print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	} elsif ($methylation_calls[$index] eq 'z') {
	  $counting{total_unmethylated_CpG_count}++;
	  print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	} elsif ($methylation_calls[$index] eq 'H') {
	  $counting{total_meCHH_count}++;
	  print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	} elsif ($methylation_calls[$index] eq 'h') {
	  $counting{total_unmethylated_CHH_count}++;
	  print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index]),"\n";
	}
	elsif ($methylation_calls[$index] eq '.') {}
	else{
	  die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n";
	}
      }
    }
    else {
      die "The strand information was neither + nor -: $strand\n";
    }
  }
}



#######################################################################################################################################
### bismark2bedGaph section - START
#######################################################################################################################################

sub process_bedGraph_output{
  warn  "="x64,"\n";
  warn "Methylation information will now be written into a bedGraph file\n";
  warn  "="x64,"\n\n";
  sleep (2);

  ### Closing all filehandles so that the Bismark methtylation extractor output doesn't get truncated due to buffering issues
  foreach my $fh (keys %fhs) {
    if ($fh =~ /^[1230]$/) {
      foreach my $context (keys %{$fhs{$fh}}) {
	close $fhs{$fh}->{$context} or die $!;
      }
    } else {
      close $fhs{$fh} or die $!;
    }
  }

  ### deciding which files to use for bedGraph conversion
  foreach my $filename (@sorting_files){
    # warn "$filename\n";
    if ($filename =~ /\//){ # if files are in a different output folder we extract the filename again
      $filename =~ s/.*\///; # replacing everything up to the last slash in the filename
      # warn "$filename\n";
    }

    if ($CX_context){
      push @bedfiles,$filename;
    }
    else{ ## CpG context only (default)
      if ($filename =~ /^CpG_/){
	push @bedfiles,$filename;
      }
      else{
	# skipping CHH or CHG files
      }
    }
  }

  warn "Using the following files as Input:\n";
  print join ("\t",@bedfiles),"\n\n";
  sleep (2);

  my %temp_fhs;
  my @temp_files; # writing all context files (default CpG only) to these files prior to sorting

  ### changing to the output directory
  unless ($output_dir eq ''){ # default
    chdir $output_dir or die "Failed to change directory to $output_dir\n";
    warn "Changed directory to $output_dir\n";
  }

  foreach my $infile (@bedfiles) {

    if ($remove) {
      warn "Now replacing whitespaces in the sequence ID field of the Bismark methylation extractor output $infile prior to bedGraph conversion\n\n";

      open (READ,$infile) or die $!;

      my $removed_spaces_outfile = $infile;
      $removed_spaces_outfile =~ s/$/.spaces_removed.txt/;

      open (REM,'>',$output_dir.$removed_spaces_outfile) or die "Couldn't write to file $removed_spaces_outfile: $!\n";

      unless ($no_header){
	$_ = <READ>;		### Bismark version header
	print REM $_;		### Bismark version header
      }

      while (<READ>) {
	chomp;
	my ($id,$strand,$chr,$pos,$context) = (split (/\t/));
	$id =~ s/\s+/_/g;
	print REM join ("\t",$id,$strand,$chr,$pos,$context),"\n";
      }
	
      close READ or die $!;
      close REM or die $!;

      ### changing the infile name to the new file without spaces
      $infile = $removed_spaces_outfile;
    }

    warn "Now writing methylation information for file $infile to individual files for each chromosome\n";
    open (IN,$infile) or die $!;

    ## always ignoring the version header
    unless ($no_header){
      $_ = <IN>;		### Bismark version header
    }
	
    while (<IN>) {
      chomp;
      my ($chr) = (split (/\t/))[2];
	
      unless (exists $temp_fhs{$chr}) {
	open ($temp_fhs{$chr},'>','chr'.$chr.'.meth_extractor.temp') or die "Failed to open filehandle: $!";
      }
      print {$temp_fhs{$chr}} "$_\n";
    }

    warn "Finished writing out individual chromosome files for $infile\n";
  }
  warn "\n";

  @temp_files = <*.meth_extractor.temp>;

  warn "Collecting temporary chromosome file information...\n";
  sleep (1);
  warn "processing the following input file(s):\n";
  warn join ("\n",@temp_files),"\n\n";
  sleep (1);

  foreach my $in (@temp_files) {
    warn "Sorting input file $in by positions\n";
    open my $ifh, "sort -k3,3 -k4,4n $in |" or die "Input file could not be sorted. $!";
    # print "Chromosome\tStart Position\tEnd Position\tMethylation Percentage\n";
	
    ############################################# m.a.bentley - moved the variables out of the while loop to hold the current line data {

    my $name;
    my $meth_state;
    my $chr = "";
    my $pos = 0;
    my $meth_state2;

    my $last_pos;
    my $last_chr;
	
    #############################################  }
	
    while (my $line = <$ifh>) {
      next if $line =~ /^Bismark/;
      chomp $line;

      ########################################### m.a.bentley - (1) set the last_chr and last_pos variables early in the while loop, before the line split (2) removed unnecessary setting of same variables in if statement {

      $last_chr = $chr;
      $last_pos = $pos;
      ($name, $meth_state, $chr, $pos, $meth_state2) = split "\t", $line;

      if (($last_pos ne $pos) || ($last_chr ne $chr)) {
	generate_output($last_chr,$last_pos) if $methylcalls[2] > 0;
	@methylcalls = qw (0 0 0);
      }

      #############################################  }
	
      my $validated = validate_methylation_call($meth_state, $meth_state2);
      unless($validated){
	warn "Methylation state of sequence ($name) in file ($in) on line $. is inconsistent (meth_state is $meth_state, meth_state2 = $meth_state2)\n";
	next;
      }
      if ($meth_state eq "+") {
	$methylcalls[0]++;
	$methylcalls[2]++;
      } else {
	$methylcalls[1]++;
	$methylcalls[2]++;
      }
    }

    ############################################# m.a.bentley - set the last_chr and last_pos variables for the last line in the file (outside the while loop's scope using the method i've implemented) {
	
    $last_chr = $chr;
    $last_pos = $pos;
    if ($methylcalls[2] > 0) {
      generate_output($last_chr,$last_pos) if $methylcalls[2] > 0;
    }
    #############################################  }
	
    close $ifh or die $!;
	
    @methylcalls = qw (0 0 0); # resetting @methylcalls

    ### deleting temporary files
    my $delete = unlink $in;
    if ($delete) {
      warn "Successfully deleted the temporary input file $in\n\n";
    }
    else {
      warn "The temporary inputfile $in could not be deleted $!\n\n";
    }
  }
}

sub generate_output{
  my $methcount = $methylcalls[0];
  my $nonmethcount = $methylcalls[1];
  my $totalcount = $methylcalls[2];
  my $last_chr = shift;
  my $last_pos = shift;
  croak "Should not be generating output if there's no reads to this region" unless $totalcount > 0;
  croak "Total counts ($totalcount) is not the sum of the methylated ($methcount) and unmethylated ($nonmethcount) counts" if $totalcount != ($methcount + $nonmethcount);

  ############################################# m.a.bentley - declare a new variable 'bed_pos' to distinguish from bismark positions (-1) - previous scripts modified the last_pos variable earlier in the script leading to problems in meth % calculation {

  my $bed_pos = $last_pos -1; ### Bismark coordinates are 1 based whereas bedGraph coordinates are 0 based.
  my $meth_percentage;
  ($totalcount >= $coverage_threshold) ? ($meth_percentage = ($methcount/$totalcount) * 100) : ($meth_percentage = undef);
  # $meth_percentage =~ s/(\.\d\d).+$/$1/ unless $meth_percentage =~ /^Below/;
  if (defined $meth_percentage){
    if ($counts){
      print OUT "$last_chr\t$bed_pos\t$bed_pos\t$meth_percentage\t$methcount\t$nonmethcount\n";
    }
    else{
      print OUT "$last_chr\t$bed_pos\t$bed_pos\t$meth_percentage\n";
    }
  }
  #############################################  }
}

sub validate_methylation_call{
  my $meth_state = shift;
  croak "Missing (+/-) methylation call" unless defined $meth_state;
  my $meth_state2 = shift;
  croak "Missing alphabetical methylation call" unless defined $meth_state2;
  my $is_consistent;
  ($meth_state2 =~ /^z/i) ? ($is_consistent = check_CpG_methylation_call($meth_state, $meth_state2)) 
                          : ($is_consistent = check_nonCpG_methylation_call($meth_state,$meth_state2));
  return 1 if $is_consistent;
  return 0;
}

sub check_CpG_methylation_call{
  my $meth1 = shift;
  my $meth2 = shift;
  return 1 if($meth1 eq "+" && $meth2 eq "Z");
  return 1 if($meth1 eq "-" && $meth2 eq "z");
  return 0;
}

sub check_nonCpG_methylation_call{
  my $meth1 = shift;
  my $meth2 = shift;
  return 1 if($meth1 eq "+" && $meth2 eq "C");
  return 1 if($meth1 eq "+" && $meth2 eq "X");
  return 1 if($meth1 eq "+" && $meth2 eq "H");
  return 1 if($meth1 eq "-" && $meth2 eq "c");
  return 1 if($meth1 eq "-" && $meth2 eq "x");
  return 1 if($meth1 eq "-" && $meth2 eq "h");
  return 0;
}

#######################################################################################################################################
### bismark2bedGaph section - END
#######################################################################################################################################






#######################################################################################################################################
### genome-wide cytosine methylation report - START
#######################################################################################################################################

sub generate_genome_wide_cytosine_report {

  warn  "="x78,"\n";
  warn "Methylation information will now be written into a genome-wide cytosine report\n";
  warn  "="x78,"\n\n";
  sleep (2);

  ### changing to the output directory again
  unless ($output_dir eq ''){ # default
    chdir $output_dir or die "Failed to change directory to $output_dir\n";
    # warn "Changed directory to $output_dir\n";
  }

  my $in = shift;
  open (IN,$in) or die $!;

  my $cytosine_out = shift;

  if ($CX_context){
    $cytosine_out =~ s/$/genome-wide_CX_report.txt/;
  }
  else{
    $cytosine_out =~ s/$/genome_wide_CpG_report.txt/;
  }

  ### note: we are still in the folder: $output_dir, so we do not have to include this into the open commands
  unless ($split_by_chromosome){ ### writing all output to a single file (default)
    open (CYT,'>',$cytosine_out) or die $!;
    warn "Writing genome-wide cytosine report to: $cytosine_out\n";
    sleep (3);
  }

  my $last_chr;
  my %chr; # storing reads for one chromosome at a time

  my $count = 0;
  while (<IN>){
    chomp;
    ++$count;
    my ($chr,$start,$end,undef,$meth,$nonmeth) = (split /\t/);

    # defining the first chromosome
    unless (defined $last_chr){
      $last_chr = $chr;
      # warn "Storing all covered cytosine positions for chromosome: $chr\n";
    }

    if ($chr eq $last_chr){
      $chr{$chr}->{$start}->{meth} = $meth;
      $chr{$chr}->{$start}->{nonmeth} = $nonmeth;
    }
    else{
      warn "Writing cytosine reports for chromosome $last_chr (stored ",scalar keys %{$chr{$last_chr}}," different covered positions)\n";

      if ($split_by_chromosome){ ## writing output to 1 file per chromosome
	my $chromosome_out = $cytosine_out;
	$chromosome_out =~ s/txt$/chr${last_chr}.txt/;
      open (CYT,'>',$chromosome_out) or die $!;
    }

      while ( $chromosomes{$last_chr} =~ /([CG])/g){
	
	my $tri_nt = '';
	my $context = '';
	my $pos = pos$chromosomes{$last_chr};
	
	my $strand;
	my $meth = 0;
	my $nonmeth = 0;
	
	if ($1 eq 'C'){    # C on forward strand
	  $tri_nt = substr ($chromosomes{$last_chr},($pos-1),3);   # positions are 0-based!
	  $strand = '+';
	}
	elsif ($1 eq 'G'){ # C on reverse strand
	  $tri_nt = substr ($chromosomes{$last_chr},($pos-3),3);   # positions are 0-based!
	  $tri_nt = reverse $tri_nt;
	  $tri_nt =~ tr/ACTG/TGAC/;
	  $strand = '-';
	}
	next if (length$tri_nt < 3); # trinucleotide sequence could not be extracted

	if (exists $chr{$last_chr}->{($pos-1)}){ # stored positions are 0-based!
	  $meth =  $chr{$last_chr}->{$pos-1}->{meth};
	  $nonmeth = $chr{$last_chr}->{$pos-1}->{nonmeth};
	}

	### determining cytosine context	
	if ($tri_nt =~ /^CG/){
	  $context = 'CG';
	}
	elsif ($tri_nt =~ /^C.{1}G$/){
	  $context = 'CHG';
	}
	elsif ($tri_nt =~ /^C.{2}$/){
	  $context = 'CHH';
	}
	else{ # if the context can't be determined the positions will not be printed (it will equally not have been reported by Bismark)
	  warn "The sequence context could not be determined (found: '$tri_nt'). Skipping.\n";
	  next;
	}

	if ($CpG_only){
	  if ($tri_nt =~ /^CG/){ # CpG context is the default
	    if ($zero){ # zero based coordinates
	      $pos -= 1;
	      print CYT join ("\t",$last_chr,$pos,$strand,$meth,$nonmeth,$context,$tri_nt),"\n";
	    }
	    else{ # default
	      print CYT join ("\t",$last_chr,$pos,$strand,$meth,$nonmeth,$context,$tri_nt),"\n";
	    }
	  }
	}
	else{ ## all cytosines, specified with --CX
	  if ($zero){ # zero based coordinates
	    $pos -= 1;
	    print CYT join ("\t",$last_chr,$pos,$strand,$meth,$nonmeth,$context,$tri_nt),"\n";
	  }
	  else{ # default
	    print CYT join ("\t",$last_chr,$pos,$strand,$meth,$nonmeth,$context,$tri_nt),"\n";
	  }
	}
      }

      %chr = (); # resetting the hash

      # new first entry
      $last_chr = $chr;
      $chr{$chr}->{$start}->{meth} = $meth;
      $chr{$chr}->{$start}->{nonmeth} = $nonmeth;
    }
  }

  # Last found chromosome
warn "Writing cytosine reports for chromosome $last_chr (stored ",scalar keys %{$chr{$last_chr}}," different covered positions)\n";

if ($split_by_chromosome){ ## writing output to 1 file per chromosome
  my $chromosome_out = $cytosine_out;
  $chromosome_out =~ s/txt$/chr${last_chr}.txt/;
  open (CYT,'>',$chromosome_out) or die $!;
}

  while ( $chromosomes{$last_chr} =~ /([CG])/g){
	
    my $tri_nt;
    my $context;
    my $pos = pos$chromosomes{$last_chr};

    my $strand;
    my $meth = 0;
    my $nonmeth = 0;

    if ($1 eq 'C'){    # C on forward strand
      $tri_nt = substr ($chromosomes{$last_chr},($pos-1),3);   # positions are 0-based!
      $strand = '+';
    }
    elsif ($1 eq 'G'){ # C on reverse strand
      $tri_nt = substr ($chromosomes{$last_chr},($pos-3),3);   # positions are 0-based!
      $tri_nt = reverse $tri_nt;
      $tri_nt =~ tr/ACTG/TGAC/;
      $strand = '-';
    }

    if (exists $chr{$last_chr}->{($pos-1)}){ # stored positions are 0-based!
      $meth =  $chr{$last_chr}->{$pos-1}->{meth};
      $nonmeth = $chr{$last_chr}->{$pos-1}->{nonmeth};
    }

    next if (length$tri_nt < 3); # trinucleotide sequence could not be extracted

    ### determining cytosine context	
    if ($tri_nt =~ /^CG/){
      $context = 'CG';
    }
    elsif ($tri_nt =~ /^C.{1}G$/){
      $context = 'CHG';
    }
    elsif ($tri_nt =~ /^C.{2}$/){
      $context = 'CHH';
    }
    else{ # if the context can't be determined the positions will not be printed (it will equally not have been reported by Bismark)
      warn "The cytosine context could not be determined (found: '$tri_nt'). Skipping.\n";
      next;
    }
	
    if ($CpG_only){
      if ($tri_nt =~ /^CG/){ # CpG context is the default
	if ($zero){ # zero-based coordinates
	  $pos -= 1;
	  print CYT join ("\t",$last_chr,$pos,$strand,$meth,$nonmeth,$context,$tri_nt),"\n";
	}
	else{ # default
	  print CYT join ("\t",$last_chr,$pos,$strand,$meth,$nonmeth,$context,$tri_nt),"\n";
	}
      }
    }
    else{ ## all cytosines, specified with --CX
      if ($zero){ # zero based coordinates
	$pos -= 1;
	print CYT join ("\t",$last_chr,$pos,$strand,$meth,$nonmeth,$context,$tri_nt),"\n";
      }
      else{ # default
	print CYT join ("\t",$last_chr,$pos,$strand,$meth,$nonmeth,$context,$tri_nt),"\n";
      }
    }
  }
  close CYT or die $!;
}


sub read_genome_into_memory{

  ## reading in and storing the specified genome in the %chromosomes hash
  chdir ($genome_folder) or die "Can't move to $genome_folder: $!";
  warn "Now reading in and storing sequence information of the genome specified in: $genome_folder\n\n";

  my @chromosome_filenames =  <*.fa>;

  ### if there aren't any genomic files with the extension .fa we will look for files with the extension .fasta
  unless (@chromosome_filenames){
    @chromosome_filenames =  <*.fasta>;
  }
  unless (@chromosome_filenames){
    die "The specified genome folder $genome_folder does not contain any sequence files in FastA format (with .fa or .fasta file extensions)\n";
  }

  foreach my $chromosome_filename (@chromosome_filenames){

    # skipping the tophat entire mouse genome fasta file
    next if ($chromosome_filename eq 'Mus_musculus.NCBIM37.fa');

    open (CHR_IN,$chromosome_filename) or die "Failed to read from sequence file $chromosome_filename $!\n";
    ### first line needs to be a fastA header
    my $first_line = <CHR_IN>;
    chomp $first_line;
    $first_line =~ s/\r//; # removing /r carriage returns

    ### Extracting chromosome name from the FastA header
    my $chromosome_name = extract_chromosome_name($first_line);
	
    my $sequence;
    while (<CHR_IN>){
      chomp;
      $_ =~ s/\r//; # removing /r carriage returns

      if ($_ =~ /^>/){
	### storing the previous chromosome in the %chromosomes hash, only relevant for Multi-Fasta-Files (MFA)
	if (exists $chromosomes{$chromosome_name}){
	  warn "chr $chromosome_name (",length $sequence ," bp)\n";
	  die "Exiting because chromosome name already exists. Please make sure all chromosomes have a unique name!\n";
	}
	else {
	  if (length($sequence) == 0){
	    warn "Chromosome $chromosome_name in the multi-fasta file $chromosome_filename did not contain any sequence information!\n";
	  }
	  warn "chr $chromosome_name (",length $sequence ," bp)\n";
	  $chromosomes{$chromosome_name} = $sequence;
	}
	### resetting the sequence variable
	$sequence = '';
	### setting new chromosome name
	$chromosome_name = extract_chromosome_name($_);
      }
      else{
	$sequence .= uc$_;
      }
    }

    if (exists $chromosomes{$chromosome_name}){
      warn "chr $chromosome_name (",length $sequence ," bp)\t";
      die "Exiting because chromosome name already exists. Please make sure all chromosomes have a unique name.\n";
    }
    else{
      if (length($sequence) == 0){
	warn "Chromosome $chromosome_name in the file $chromosome_filename did not contain any sequence information!\n";
      }
      warn "chr $chromosome_name (",length $sequence ," bp)\n";
      $chromosomes{$chromosome_name} = $sequence;
    }
  }
  warn "\n";
  chdir $parent_dir or die "Failed to move to directory $parent_dir\n";
}

sub extract_chromosome_name {
  ## Bowtie extracts the first string after the inition > in the FASTA file, so we are doing this as well
  my $fasta_header = shift;
  if ($fasta_header =~ s/^>//){
    my ($chromosome_name) = split (/\s+/,$fasta_header);
    return $chromosome_name;
  }
  else{
    die "The specified chromosome ($fasta_header) file doesn't seem to be in FASTA format as required!\n";
  }
}

#######################################################################################################################################
### genome-wide cytosine methylation report - END
#######################################################################################################################################




sub print_helpfile{

 print << 'HOW_TO';


DESCRIPTION

The following is a brief description of all options to control the Bismark
methylation extractor. The script reads in a bisulfite read alignment results file 
produced by the Bismark bisulfite mapper and extracts the methylation information
for individual cytosines. This information is found in the methylation call field
which can contain the following characters:

       ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
       ~~~   X   for methylated C in CHG context (was protected)     ~~~
       ~~~   x   for not methylated C CHG (was converted)            ~~~
       ~~~   H   for methylated C in CHH context (was protected)     ~~~
       ~~~   h   for not methylated C in CHH context (was converted) ~~~
       ~~~   Z   for methylated C in CpG context (was protected)     ~~~
       ~~~   z   for not methylated C in CpG context (was converted) ~~~
       ~~~   .   for any bases not involving cytosines               ~~~
       ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

The methylation extractor outputs result files for cytosines in CpG, CHG and CHH
context (this distinction is actually already made in Bismark itself). As the methylation
information for every C analysed can produce files which easily have tens or even hundreds of
millions of lines, file sizes can become very large and more difficult to handle. The C
methylation info additionally splits cytosine methylation calls up into one of the four possible
strands a given bisulfite read aligned against:

             OT      original top strand
             CTOT    complementary to original top strand

             OB      original bottom strand
             CTOB    complementary to original bottom strand

Thus, by default twelve individual output files are being generated per input file (unless
--comprehensive is specified, see below). The output files can be imported into a genome
viewer, such as SeqMonk, and re-combined into a single data group if desired (in fact
unless the bisulfite reads were generated preserving directionality it doesn't make any
sense to look at the data in a strand-specific manner). Strand-specific output files can
optionally be skipped, in which case only three output files for CpG, CHG or CHH context
will be generated. For both the strand-specific and comprehensive outputs there is also
the option to merge both non-CpG contexts (CHG and CHH) into one single non-CpG context.


The output files are in the following format (tab delimited):

<sequence_id>     <strand>      <chromosome>     <position>     <methylation call>


USAGE: methylation_extractor [options] <filenames>


ARGUMENTS:

<filenames>              A space-separated list of Bismark result files in SAM format from
                         which methylation information is extracted for every cytosine in
                         the reads. For alignment files in the older custom Bismark output
                         see option '--vanilla'.

OPTIONS:

-s/--single-end          Input file(s) are Bismark result file(s) generated from single-end
                         read data. Specifying either --single-end or --paired-end is
                         mandatory.

-p/--paired-end          Input file(s) are Bismark result file(s) generated from paired-end
                         read data. Specifying either --paired-end or --single-end is
                         mandatory.

--vanilla                The Bismark result input file(s) are in the old custom Bismark format
                         (up to version 0.5.x) and not in SAM format which is the default as
                         of Bismark version 0.6.x or higher. Default: OFF.

--no_overlap             For paired-end reads it is theoretically possible that read_1 and
                         read_2 overlap. This option avoids scoring overlapping methylation
                         calls twice (only methylation calls of read 1 are used for in the process
                         since read 1 has historically higher quality basecalls than read 2).
                         Whilst this option removes a bias towards more methylation calls
                         in the center of sequenced fragments it may de facto remove a sizable
                         proportion of the data. This option is highly recommended for paired-end
                         data.

--ignore <int>           Ignore the first <int> bp at the 5' end of each read when processing the
                         methylation call string. This can remove e.g. a restriction enzyme site
                         at the start of each read.

--comprehensive          Specifying this option will merge all four possible strand-specific 
                         methylation info into context-dependent output files. The default 
                         contexts are:
                          - CpG context
                          - CHG context
                          - CHH context

--merge_non_CpG          This will produce two output files (in --comprehensive mode) or eight
                         strand-specific output files (default) for Cs in
                          - CpG context
                          - non-CpG context

--report                 Prints out a short methylation summary as well as the paramaters used to run
                         this script.

--no_header              Suppresses the Bismark version header line in all output files for more convenient
                         batch processing.

-o/--output DIR          Allows specification of a different output directory (absolute or relative
                         path). If not specified explicitely, the output will be written to the current directory.

--version                Displays version information.

-h/--help                Displays this help file and exits.



bedGraph specific options:

--bedGraph               After finishing the methylation extraction, the methylation output is written into a
                         sorted bedGraph file that reports the position of a given cytosine and its methylation 
                         state (in %, seem details below). The methylation extractor output is temporarily split up into
                         temporary files, one per chromosome (written into the current directory or folder
                         specified with -o/--output); these temp files are then used for sorting and deleted
                         afterwards. By default, only cytosines in CpG context will be sorted. The option
                         '--CX_context' may be used to report all cyosines irrespective of sequence context
                         (this will take MUCH longer!).


--cutoff [threshold]     The minimum number of times a methylation state has to be seen for that nucleotide
                         before its methylation percentage is reported. Default: 1.

--remove_spaces          Replaces whitespaces in the sequence ID field with underscores to allow sorting.


--counts                 Adds two additional columns to the output file to enable further calculations:
                             col 5: number of methylated calls
                             col 6: number of unmethylated calls
                         This option is required if '--cytosine_report' is specified (and will be set automatically if
                         necessary).

--CX/--CX_context        The sorted bedGraph output file contains information on every single cytosine that was covered
                         in the experiment irrespective of its sequence context. This applies to both forward and
                         reverse strands. Please be aware that this option may generate large temporary and output files
                         and may take a long time to sort (up to many hours). Default: OFF.
                         (i.e. Default = CpG context only).



Genome-wide cytosine methylation report specific options:

--cytosine_report        After the conversion to bedGraph has completed, the option '--cytosine_report' produces a
                         genome-wide methylation report for all cytosines in the genome. By default, the output uses 1-based
                         chromosome coordinates (zero-based cords are optional) and reports CpG context only (all
                         cytosine context is optional). The output considers all Cs on both forward and reverse strands and
                         reports their position, strand, trinucleotide content and methylation state (counts are 0 if not
                         covered).

--CX/--CX_context        The output file contains information on every single cytosine in the genome irrespective of
                         its context. This applies to both forward and reverse strands. Please be aware that this will
                         generate output files with > 1.1 billion lines for a mammalian genome such as human or mouse.
                         Default: OFF (i.e. Default = CpG context only).

--zero_based             Uses zero-based coordinates like used in e.g. bed files instead of 1-based coordinates. Default: OFF.

--genome_folder <path>   Enter the genome folder you wish to use to extract sequences from (full path only). Accepted
                         formats are FastA files ending with '.fa' or '.fasta'. Specifying a genome folder path is mandatory.

--split_by_chromosome    Writes the output into individual files for each chromosome instead of a single output file. Files
                         will be named to include the input filename and the chromosome number.



OUTPUT:

The bismark_methylation_extractor output is in the form:
========================================================
<seq-ID>  <methylation state*>  <chromosome>  <start position (= end position)>  <methylation call>

* Methylated cytosines receive a '+' orientation,
* Unmethylated cytosines receive a '-' orientation.



The bedGraph output (optional) looks like this (tab-delimited):
===============================================================
<chromosome>  <start position>  <end position>  <methylation percentage>



The genome-wide cytosine methylation output file is tab-delimited in the following format:
==========================================================================================
<chromosome>  <position>  <strand>  <count methylated>  <count non-methylated>  <C-context>  <trinucleotide context>



This script was last modified on 02 Oct 2012.

HOW_TO
}
