Metadata-Version: 2.1
Name: filter_illumina_index
Version: 1.0.4.dev2
Summary: Filter a Illumina FASTQ file based on index sequence
Home-page: https://github.com/twlee79/filter_illumina_index
Author: Tet Woo Lee
Author-email: developer@twlee.nz
License: UNKNOWN
Description: # filter_illumina_index
        ## Filter a Illumina FASTQ file based on index sequence.
        
        Reads a Illumina FASTQ file and compares the sequence index in the
        `sample number` position of the sequence identifier to a supplied sequence
        index. Entries that match the sequence index are filtered into the *filtered
        file* (if any) and entries that don't match are filtered into the *unfiltered
        file* (if any). Displays the count of total, filtered and unfiltered reads,
        as well as the number of mismatches found across all reads. Matching tolerating
        a certain number of mismatches (`-m` parameter), and gzip compression for input
        (detected on the basis of file extension) and output (specified using `-c`
        parameter) are supported.
        
        Specifying an empty index, (`-i ""` or `-i` with no argumenent) enables
        'passthrough' mode where all reads are directed to the output filtered file with
        no processing. Passthrough mode is useful if this program is part of a workflow
        that needs to be adapted to files that do not have a valid Illumina index, as it
        allows all processing of this program to be skipped.
        
        For information on Illumina sequence identifiers in FASTQ files, see:
        http://support.illumina.com/content/dam/illumina-support/help/BaseSpaceHelp_v2/Content/Vault/Informatics/Sequencing_Analysis/BS/swSEQ_mBS_FASTQFiles.htm
        
        ### Usage details
        
        ```
        usage: filter_illumina_index [-h] [--version] [-f FILTERED] [-u UNFILTERED] -i
                                     [INDEX] [-m MISMATCHES] [-c] [-v]
                                     inputfile
        
        positional arguments:
          inputfile             Input FASTQ file, compression supported
        
        optional arguments:
          -h, --help            show this help message and exit
          --version             show program's version number and exit
          -f FILTERED, --filtered FILTERED
                                Output FASTQ file containing filtered (positive) reads
                                (default: None)
          -u UNFILTERED, --unfiltered UNFILTERED
                                Output FASTQ file containing unfiltered (negative)
                                reads (default: None)
          -m MISMATCHES, --mismatches MISMATCHES
                                Maximum number of mismatches to tolerate (default: 0)
          -c, --compressed      Compress output files (note: file extension not
                                modified) (default: False)
          -v, --verbose         Show verbose output (default: False)
        
        required named arguments:
          -i [INDEX], --index [INDEX]
                                Sequence index to filter for; if empty (i.e. no
                                argument or "") then program will run in "passthrough"
                                mode with all reads directed to filtered file with no
                                processing (default: None)
        ```
        
        ### Example usage
        
        The directory `` contains example reads in FASTQ and compressed FASTQ format with index `GATCGTGT` and one read with a mismatch.
        
        To test, run:
        
        `filter_illumina_index usr/example_reads.fastq --index GATCGTGT --filtered var/filtered_reads.fastq --unfiltered var/unfiltered_reads.fastq`
        
        python filter_illumina_index/filter_illumina_index.py usr/example_reads.fastq --index GATCGTGT 
        filter_illumina_index 1.0.4.dev1
        Input file: usr/example_reads.fastq
        Filtering for sequence index: GATCGTGT
        Max mismatches tolerated: 0
        Output filtered file: None
        Output unfiltered file: None
        Total reads: 30
        Filtered reads: 29
        Unfiltered reads: 1
         Reads with 0 mismatches: 29
         Reads with 1 mismatches: 1
         Reads with 2 mismatches: 0
         Reads with 3 mismatches: 0
         Reads with 4 mismatches: 0
         Reads with 5 mismatches: 0
         Reads with 6 mismatches: 0
         Reads with 7 mismatches: 0
         Reads with 8 mismatches: 0
         Reads with >=9 mismatches: 0
        
        This will process `srv/example_reads.fastq`, matching to index `GATCGTGT` with
        no mismatches allowed (default). Reads matching this index will be saved to
        `var/filtered_reads.fastq` and those not matching this index will be saved to
        `var/unfiltered_reads.fastq`. In addition, the following output will be
        displayed:
        
        ```
        filter_illumina_index 1.0.4.dev1
        Input file: usr/example_reads.fastq
        Filtering for sequence index: GATCGTGT
        Max mismatches tolerated: 0
        Output filtered file: None
        Output unfiltered file: None
        Total reads: 30
        Filtered reads: 29
        Unfiltered reads: 1
         Reads with 0 mismatches: 29
         Reads with 1 mismatches: 1
         Reads with 2 mismatches: 0
         Reads with 3 mismatches: 0
         Reads with 4 mismatches: 0
         Reads with 5 mismatches: 0
         Reads with 6 mismatches: 0
         Reads with 7 mismatches: 0
         Reads with 8 mismatches: 0
         Reads with >=9 mismatches: 0
        ```
        
        ### Algorithm details
        
        The barcode is read from the sequence number position of the sequence identifier
        using a very simplistic method to optimise performance: the field in the
        sequence identifier following the last colon (`:`) character is used, e.g.
        
        ```
        @FAKE-SEQ:1:FAKE-FLOWCELL-ID:1:1:0:1 1:N:0:TGACCAAT
                                                  ^         : last colon
                                                   ^^^^^^^^ : taken
                                                   TGACCAAT : barcode
        ```
        
        The number of mismatches is simply the number of characters that differ between
        the provided index sequence and the barcode from the read. Any missing
        characters in either the provided index or the barcode are counted as
        mismatches. The comparison is performed at the start of the each set of
        characters with no provision for wildcards, insertions or deletions, e.g.
        
        ```
        TGACCAAT index
        TGACCAAT read barcode
                 0 mismatches
        
        TGACCAAT index
        AGACCAAT read barcode
        ^        1 mismatch
        
        TGACCAAT index
        GACCAAT  read barcode
        ^^^ ^ ^^ 6 mismatches
        
        TGACCAAT index
        TGACCAAAA read barcode
               ^^ 2 mismatches
        
        TGACCAAT index
        NNNCCAAT read barcode
        ^^^      3 mismatches
        
        NNNCCAAT index
        TGACCAAT read barcode
        ^^^      3 mismatches
        
        NNNCCAAT index
        NNNCCAAT read barcode
                 0 mismatches
        
        TGACCAAT index
        TGACCAATTGACCAATTGACCAAT read barcode
                ^^^^^^^^^^^^^^^^ 16 mismatches
        ```
        
        Where there is a greater number of characters in the read barcode than the
        provided index, the number of mismatches is summarised as `>=index length+1`,
        i.e. the final entry above will be counted as >=9 mismatches.
        
        ### File reading/writing and threading
        
        This script uses the `dnaio` and `xopen` packages for reading/writing FASTQ
        files with compression support. The `xopen` package used for reading/writing
        compressed files spawns `pigz` processes to speed-up processing. The `--threads`
        parameter indicates the number of threads passed to the `xopen()` function. With
        `--threads 1` there is still a small amount of multithreading as a different
        `pigz` process is spawned for each open file and up to 3 files are open at once
        (one input and two output), although this is largely throttled by the sequential
        nature of the script processing. To prevent these `pigz` processes being
        spawned, `--threads 0` can be used, which causes a fallback to `gzip.open` at
        an additional performance cost (it is slower than `pigz`).
        
        `xopen` supports automatic compression according to the file extension, with
        `.gz`, `.bz2` and `.xz` supported. Only the first of these has been tested
        with this script but the others are expected to work without issue.
        
        ---
        
        ### Additional details
        
        * Author:       Tet Woo Lee
        * Copyright:    © 2018-2020 Tet Woo Lee
        * Licence:      GPLv3
        * Dependencies:  
          dnaio, tested with v0.4.1  
          xopen, tested with v0.8.4
        
        
        ### Change log
        
        version 1.0.3.post2 2020-01-04  
        Improved output
          - Add version number to output
          - Show parameters in output
          - Allow no argument for passthrough mode
        
        version 1.0.3.post1 2020-01-04  
        Minor bugfix
          - Bugfix: Bump version number in script
        
        version 1.0.3 2020-01-04  
        Added `passthrough` mode with empty index
        
        version 1.0.2 2018-12-19  
        Shows statistics on number of mismatches found
        
        version 1.0.1 2018-12-19  
        Speed up number of mismatches calculation
        
        version 1.0 2018-12-14  
        Minor updates for PyPi and conda packaging
        
        version 1.0.dev1 2018-12-13  
        First working version
        
Platform: UNKNOWN
Classifier: Programming Language :: Python :: 3
Classifier: License :: OSI Approved :: GNU General Public License v3 (GPLv3)
Classifier: Operating System :: OS Independent
Description-Content-Type: text/markdown
