Metadata-Version: 2.4
Name: asodesigner
Version: 0.1.1
Summary: Feature extraction and analysis toolkit for antisense oligonucleotide design.
Author: TAU-Israel iGEM Team
Project-URL: Homepage, https://2025.igem.wiki/tau-israel/home
Keywords: antisense,oligonucleotide,bioinformatics,igem
Classifier: Development Status :: 3 - Alpha
Classifier: Intended Audience :: Science/Research
Classifier: Programming Language :: Python :: 3
Classifier: Programming Language :: Python :: 3.9
Classifier: Programming Language :: Python :: 3.10
Classifier: Programming Language :: Python :: 3.11
Classifier: Programming Language :: Python :: 3.12
Classifier: Topic :: Scientific/Engineering :: Bio-Informatics
Requires-Python: <3.13,>=3.9
Description-Content-Type: text/markdown
License-File: LICENSE
Requires-Dist: numpy
Requires-Dist: pandas
Requires-Dist: scipy
Requires-Dist: matplotlib
Requires-Dist: numba
Requires-Dist: biopython
Requires-Dist: ViennaRNA
Requires-Dist: primer3-py
Requires-Dist: gffutils
Requires-Dist: codon-bias
Requires-Dist: fuzzysearch
Requires-Dist: tqdm
Requires-Dist: multiprocess
Requires-Dist: gget
Dynamic: license-file

# ASOdesigner

ASOdesigner provides feature extraction utilities that support the design of antisense oligonucleotides (ASOs). The
package bundles folding, accessibility, and sequence analysis helpers that were originally created for the TAU-Israel
2025 iGEM project.

## Installation

You can install the library directly from PyPI once it is published:

```bash
pip install asodesigner
```

For local development and experimentation inside this repository, install the package in editable mode together with
its runtime dependencies:

```bash
pip install -r requirements.txt
```

## Usage

Functions are organised by module. For example, to compute a few sequence-derived features:

```python
from asodesigner import seq_features

enc = seq_features.compute_ENC("ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG")
gc = seq_features.get_gc_content("ATGGCC")
```

Refer to the individual module docstrings for detailed behaviour and expected inputs.

## Development Workflow

1. Update or add functionality under `src/asodesigner/`.
2. Keep imports relative within the package (for example, use `from .util import helper`).
3. Run `python -m compileall src/asodesigner` or your preferred test suite to make sure the code still imports
   correctly.

## Building and Publishing to PyPI

The project uses a modern `pyproject.toml` driven build. To prepare a release:

1. **Choose a version** – bump the version field in `pyproject.toml` following semantic versioning.
2. **Build the artifacts**:
   ```bash
   python -m build
   ```
3. **Inspect the build** – verify the generated wheel and source distribution under `dist/`.
4. **Upload to PyPI** (or TestPyPI first) using `twine`:
   ```bash
   python -m twine upload dist/*
   ```

Remember that publishing requires a PyPI account and API token. For TestPyPI, swap the repository URL accordingly.

## License

The code is released under the Creative Commons Attribution 4.0 International License (CC BY 4.0). See `LICENSE` for
full details.
