Metadata-Version: 1.1
Name: amphipathic
Version: 0.3.0
Summary: This is a library to evaluate an aminoacid sequence and determine an amphipathic index for each alpha helix or beta sheet.
Home-page: https://github.com/ecolell/amphipathic
Author: Eloy Adonis Colell
Author-email: eloy.colell@gmail.com
License: MIT
Description: amphipathic
        ===========
        
        [![License](https://img.shields.io/pypi/l/amphipathic.svg)](https://raw.githubusercontent.com/ecolell/amphipathic/master/LICENSE) [![Downloads](https://img.shields.io/pypi/dm/amphipathic.svg)](https://pypi.python.org/pypi/amphipathic/) [![Build Status](https://travis-ci.org/ecolell/amphipathic.svg?branch=master)](https://travis-ci.org/ecolell/amphipathic) [![Coverage Status](https://coveralls.io/repos/ecolell/amphipathic/badge.png)](https://coveralls.io/r/ecolell/amphipathic) [![Code Health](https://landscape.io/github/ecolell/amphipathic/master/landscape.png)](https://landscape.io/github/ecolell/amphipathic/master) [![PyPI version](https://badge.fury.io/py/amphipathic.svg)](http://badge.fury.io/py/amphipathic)
        
        This is a library to evaluate an aminoacid sequence and determine an amphipathic index for each alpha helix or beta sheet.
        
        Requirements
        ------------
        
        If you want to use this library on any GNU/Linux or OSX system you just need to execute:
        
            $ pip install amphipathic
        
        
        If you want to collaborate with this library, you should download the [github repository](https://github.com/ecolell/amphipathic) and execute:
        
            $ make deploy
        
        
        Testing
        -------
        
        To test all the project you should use the command:
        
            $ make test
        
        
        Example
        -------
        
        This library can analyze an aminoacid sequence and gives a list of secondary structures with the respective index: 
        
        ```python
        import amphipathic
        resume = amphipathic.index('NLYIQWLKDGGPSSGRPPPS') 
        print resume
        ```
        
        And the result should be:
        
        ```python
        [[
            {'end': 2,
             'begin': 0,
             'type': u'c',
             'seq': 'nl',
             'amphipathic': {'index': 7.572935321054872e-05, 'mean': 2.6}},
            {'end': 5,
             'begin': 2,
             'type': u'e',
             'seq': 'yiq',
             'amphipathic': {'index': 1.4312912272216411, 'mean': 1.7299999999999998}},
            {'end': 18,
             'begin': 5,
             'type': u'c',
             'seq': 'wlkdggpssgrpp',
             'amphipathic': {'index': 0.002511560979331271, 'mean': -0.43}},
            {'end': 20,
             'begin': 18,
             'type': u'e',
             'seq': 'ps',
             'amphipathic': {'index': 1.6242872515167746, 'mean': -1.34}}
        ]]
        ```
        
        It also accept a nucleotide sequence to perform the same analysis:
        
        ```python
        import amphipathic
        resume = amphipathic.index('cgcgtccttggagcaatgcagttcaagaccaagaatcgaattgaacctgt') 
        print resume
        ```
        
        And the output:
        
        ```python
        [[
            {'end': 12,
             'begin': 0,
             'type': u'c',
             'seq': 'rvlgamqfktkn',
             'amphipathic': {'index': 0.007560225956225585, 'mean': 0.7825000000000001}},
            {'end': 15,
             'begin': 12,
             'type': u'e',
             'seq': 'rie',
             'amphipathic': {'index': 1.6297837670649824, 'mean': 1.4599999999999997}},
            {'end': 16,
             'begin': 15,
             'type': u'c',
             'seq': 'p',
             'amphipathic': {'index': 0.0, 'mean': -2.23}}
        ]]
        ```
        
        Last, it also accept a polyprotein sequence. When working with aminoacid it detect the '*' character as a stop signal:
        
        ```python
        import amphipathic
        resume = amphipathic.index('NLYIQWLKDG*GPSSGRPPPS') 
        print resume
        ```
        
        
        Questions?
        ----------
        
        If you want to develope with us or have questions about this library, please file an issue in this repository so some of the project managers can get back to you. Please check the existing (and closed) issues to make sure your issue hasn't already been addressed.
        
Platform: UNKNOWN
Classifier: Intended Audience :: Science/Research
Classifier: Programming Language :: Python
Classifier: Programming Language :: Python :: 3.6
Classifier: Topic :: Scientific/Engineering :: Bio-Informatics
Classifier: Topic :: Scientific/Engineering :: Information Analysis
Classifier: Topic :: Scientific/Engineering :: Physics
